



But there is one thing that distinguishes this 20-year-old from her peers, something that has made her the unwitting focus of an intense public debate about what exactly it means to be Chinese: the color of her skin. Born to a Chinese mother and an African-American father whom she has never met, the theater student rocketed into the public consciousness last month when she took part in an American Idol–esque TV show, Go! Oriental Angel.
(See pictures of modern Shanghai.)
The marketing gurus for the series could hardly have dreamed of a better promotional gimmick when they started to investigate the backgrounds of the dozens of pop-star wannabes to root out the competitors' mushy stories of triumph over adversity that are a well-worn staple of the genre. Here was a tale guaranteed to attract eyeballs: a girl of mixed race, brought up by a single Chinese mother, struggling to gain acceptance in a deeply conservative, some would say racist, society.
The strategy worked — perhaps too well. In August, Lou's appearance on the show not only boosted viewer numbers but also sparked an intense nationwide debate about the essential meaning of being Chinese. Over the past month on Internet chat rooms, where modern China's sensitive issues are thrashed out by netizens long before they reach the heavily censored mainstream media, Lou's ethnicity has been the subject of a relentless barrage of criticism, some of it crudely racist. Many think she should not have been allowed to compete on a Chinese show, or at least not selected to represent Shanghai in the national competition. She doesn't have fair skin, which is one of the most important factors for Chinese beauty. What's more, her mother and her biological father were never married; morally, the argument goes, this kind of behavior shouldn't be publicized, so she shouldn't have been put on TV as a young "idol."
These kinds of posts on the most popular chat rooms have attracted thousands of comments. A few have been supportive of Lou, but the rest range from expressions of fear and ignorance to outright racism. One of the most popular posts about Lou Jing on the KDS Life forum asked in mock seriousness, "Is it possible that she is Obama's daughter?" Another poster said, "I can't believe she's so shameless that she would go on TV." Most of the critics are agreed on one point: that this black woman cannot be regarded as a "real" Chinese.
As recently as the 1970s, foreigners were largely barred from living in China, let alone marrying a local. China does not easily accept mixed-race children as true-blooded Chinese: as soon as a child is born, the parents are required to register with the authorities as to which of the 56 government-approved ethnic groups their child belongs; there are no mixed-race categories. Lou feels she is very much Chinese. "When I meet somebody for the first time, they'd often ask me how I can speak Chinese so well, and I tell them, 'Because I'm a Chinese — of course I can speak my mother tongue well,' " Lou says defiantly. "I don't like to be treated differently."
As China undergoes an astonishing demographic shift and more foreigners make their homes in the Middle Kingdom, Lou is by no means the only one being treated differently. Recent decades have seen a surge in the number of mixed-race couples. According to the data offered by Shanghai Civil Affairs Bureau, from 1994 to 2008, each year there have been about 3,000 more mixed-race marriages in Shanghai. But as the children of that first generation of mixed-race marriages come of age, their moves to gain acceptance in society — like Lou's participation in the TV show — have exposed a deep-running vein of xenophobia in Chinese society. Last year, Ding Hui, a young man of African-Chinese ethnicity, caused a stir when he was called up to the national volleyball team, prompting much soul-searching about whether the athlete should be allowed to represent China alongside pure-blooded Chinese competitors. Eventually, Ding Hui did go on to play for the national team.
"As China continues to open up, this kind of phenomenon will become ever more prevalent," says David Zweig, a professor of humanities and social sciences at the Hong Kong University of Science and Technology. "This is part of the process of internationalization, but we can only hope that Chinese people, including netizens and the people whose views tend towards extremism, can come to accept that there are many mixed-race people, both in China and worldwide."
As for Lou, she found the whole experience more than a little disturbing. She did well in the show, ranking in the top 30 contestants before she was eliminated. Now she's back to her normal life as a college junior — with a little new insight into her home. "Through this competition, it's really scary to find out how the color of my skin can cause such a big controversy."
Here are some of the comments that people were posting online ............
Shanghai people’s value plunges. A bastard, brought her out to show off because of the foreigner descent. The girl is ok, her mom is a whore, married and still mess around with black guy, maybe it’s the great “love”, it’s a pity the black guy was just playing her, Chinese girls please have some self-respect.
Her mother still has the face to go on stage, she is shameless, and this kind of thing is definitely scandals you should keep in the family. She still dares to go on stage, maybe she does not feel ashamed, instead feels proud. Is this the legend of the bastard? And an unwanted bastard.
Her mother is a shameless woman, pregnant by a black guy, and then abandoned, was it good when he was pleasing you? Still obsessed with him after several decades? Not feel ashamed, even go on TV to look, looking for what? Looking for lost big XX? Looking for climax never had again? Shameless! Why are Shanghai women always the target of criticism? It’s because of shameless bitch like her! Dragon TV please help this bastard find her family. Let the black father with a big XX hurry back, address this old woman’s needs! Black Dad, come back soon! Someone cannot forget your big XX.
This woman has no sense of shame, married and you cheat, give birth to a black kid so there is no way to hide, if wasn’t for that her husband will have to raise their children.
Cheap is the word, in order to run with a foreigner, even do with black people.

From Chinasmack.com
www.chinasmack.com/stories/shanghai-black-girl-lou-jing-racist-chinese-netizens/
Shanghai ‘Black Girl’ Lou Jing Abused By Racist Netizens
When singer Lou Jing entered the Chinese TV talent show Go Oriental Angel she was proud to be representing her city of Shanghai.
But she didn't expect to became the subject of abusive internet comments about her skin colour - some of them telling her to "get out of China".
Twenty year old Lou Jing is from a mixed race background, leading some viewers to cruelly call her "no oriental angel."
The daughter of a Chinese mother and an African American father, she and her family were shocked by the reaction of the Chinese public.
Matthew Bannister spoke to Lou Jing about her experiences and her new career co-presenting a programme called "new surfing the intelligence."
From NetEase:
Shanghai “Black girl” Lou Jing becomes famous on the internet
Lou Jing [shown with mother above], who participated in DragonTV’s “Jia you! Oriental Angels“, recently became exceptionally popular on the internet, having been cursed to fame by netizens! Lou Jing was viciously abused owning to her life experience. Many netizens learned that Lou Jing was born after her married mother had [extra-marital] relations with a black man, and let loose a torrent of abuse on the internet. August 30, Lou Jing issued on the internet a stern but fair protest against netizens’ racism, that the color of her skin should not become a target of attack. At the same time, she also said she reserved the right to take legal action.
From KDS:
Shanghai’s most green [cuckolded] man, whose wife gives birth to a black man’s child~~
Lou Jing’s mother had a husband, then had an extramarital affair with a black man, then gave birth to Lou Jing, and then after her birth divorced.
And that black devil, after fucking ran back to his home in Africa.
It is unimaginable how that Shanghainese man [husband], excited and anxious to see his own “daughter”, must have felt when he saw that she was black…
A response by Lou Jing on KDS:
I am DragonTV Angel Lou Jing, and here I make a statement!
My father is American, not African.
I am a born and bred Shanghainese person.
I should not have to bear my parents’ mistake, I am innocent!
Sternly but strongly protest some people’s racism, my skin color should not become a target of attack!
I reserve the right to take legal action!
Comments from KDS:
hsxxl:
Would this be a green hat or a black hat?
看低2800点:
Her mom really knows how to enjoy herself
erick:
Even going on television…what is this show trying to promote? Extra-marital affairs…?
sara:
This mother is really horny.
Jesse_Q:
Her mother’s skin is pretty thick.
At the time finding foreigners was indeed a fad, but you still can’t pick blacks!
滢滢:
Kao.
Fucked by a black.
How come a zebra wasn’t born…?
黑丫子:
Ugh. Yellow people and black people mixed together is very gross…only black skin, not yellow skin, chocolate skin…
Not even knowing this common knowledge, ruining a child’s life.
Lyna:
There are still a lot of this kind of women that would get involved with blacks~
Her old mother at the time had courage, probably also did not know what color would she would give birth to, white, yellow, all possible, right…?
K-I:
She does not have it easy either.
She’s still better than those men and women these days who treat abortion like a trivial matter.
Moreover, her mother was not married.
If the men in this post are all so enthusiastic about attacking her,
then you guys better take care of your own lives.
小艾Deryck:
Can that black person’s home see DragonTV? …
篮球暴男:
Numb! This bitch still has the audacity to appear on television! I don’t know what to say! One cannot be shameless to this kind of level!
手刹车:
Black people actually have a pretty high standing internationally, many famous fashion models and stars are all married to black people.
However in China, this kind of thing is a little embarrassing/shameful.
Bblueye:
I think this mother is still very great/admirable.
Willing to face her own mistakes, I ask how many TF here would dare to face [such mistakes].
A single mother able to bring up a daughter is already very difficult/impressive, much less one with a different skin color, the difficulties are imaginable.
Everyone has the ability to analyze what is right, what is wrong. Everyone think about it, don’t be so immature, opening your mouth to hurl abuse without thinking. Be a bit more understanding with other people.
伐要弄管:
I think Lou Jing should not be condemned, she herself did nothing wrong, and if her father was an American white person, she probably would not be discriminated against. In the end, it is still racism.
包龙星:
Black people’s tools/weapons are big! Her mother must have been very satisfied! Even having the audacity to go on television! Probably hoping that Africa can see [the television show], and [the father] will come to recognize his daughter, haha!
另壺蔥:
But you guys should not forget…black women’s bodies are the best in the world…
The modeling industry and entertainment industry all have a lot of black women…
一天又一天:
There is news saying that black person is T-MAC’s [Tracy McGraw, NBA player] cousin.
向日葵皇帝:
Obama’s little sister.
Similarities: Male black dog x different skin colored woman.
Differences: Black x White = Obama, Black x Yellow = Luo Jing.
Comments from Tianya:
jiyangjiang:
Having this kind of woman as a mother, truly lamentable.
老实人春生:
There is nothing wrong with the daughter, but her mother is indeed a bitch/slut, married but still getting involved with a black person, probably for the great “love” too. Too bad the black man treated her as a toy. Chinese girls, please have a little more self-respect.
波小斯:
The television channel is also shameless, using this kind of thing to hype/promote/attract attention [to itself].
I imagine her mother is also feeling helpless, bringing out and talking about such a shameful past, and ultimately [in hopes of helping] her daughter.
Miss_Q:
I cannot help but say, those coming out of mixing yellow and black blood are all truly ugly, a dirty feeling [appearance]…
phoenix81:
I do not know why,
but after seeing these photographs, my mind is reminded of Japanese-made adult videos, with the final climax scene of the black man, where the black man’s muscular body tightly pressed on the Japanese woman’s white and tender skin, pulling out after shuddering from climax, and then so many seconds of close-up — of vaginal liquids and semen everywhere.
One or several times N years ago, this Lou Jing’s mother along with a black person also played out such a scene.
This black man’s daughter is truly deserving of pity. The mistake is not on her, but on her mother’s and that black biological father.
GOLAKER1:
Girls, you guys should know that even in America, which represents the highest level of black people, 60% of black children are brought up by their mothers alone. Do you understand what this means?
It means the men all fucked and ran, not taking responsibility for anything! There are often black people who have had children with over 10 different women, that American netizens all ask that they be castrated…
藍天白雲輕風:
When I first saw this week’s show, I too was very shocked, so stunned. Society’s norms and values haven’t becomes so “fei zhu liu“, has it? As a post-80s generation, I completely cannot accept this. If I were that girl, I would be so low key that I could not be any more low key. How could I possibly come out and expose my face, seeking attention and sympathy…it is difficult to understand.
美女也爱国:
How much self-respect could the child of a shameless old woman be?
And she still wants to find her American father. Who knows if her father is in jail for being unable to repay his loans or dead from a gun fight on the streets.
Judging by her mother’s story, it seems like her mother was not very familiar with her American black father anyway, so trying to find…America’s already has a bunch of black children trying to find their own biological fathers.
yimihai:
I am not racist, but if her mother really was married first and got involved with a black person, then that is indeed low. What more, not knowing to use contraceptives or abortion, could she have really been thinking of using a child to tie down a foreigner? Truly both low and deplorable.
The child is innocent…
, can’t I?
Reply
+16jay says:
Sunday, October 18, 2009 at 3:45 am
Although you are clearly upset, and you have the right to be, your comment is just as ignorant and racist as the negative comments people are posting about Lou Jing.
There are many chinese people who do not feel this way about blacks and are actually open-minded enough to not feel this way. Your comments about creating a “community of blacks” and boycotting chinese food just shows how you are stereo-typing all chinese.
The treatment Lou Jing is getting is obviously wrong and many of us believe this and support her in her endeavors. You say that you will not go to any more chinese restaurants, and what about other chinese businesses? Your association with chinese people and chinese food only shows how ignorant you are. Chinese people are not ONLY GOOD for making chinese food. For you to call out not only chinese people, but all “middle easterns” and grouping everyone together is not only racist but a fine example of why this world will always stay the way it is–filled with hatred and retaliation rather than understanding.
If you want to make a comment or express your feelings, please do not stereotype. When you do, people stop listening, realizing that you are only furthering the racism that fueled this in the first place. I wish I can respect your comment and opinion, but because of the ways you have stated them, I cannot support them or even say I understand where you are coming (although I have experienced racism many times).
Your “dream” is one of a world that is segregated. Neighborhoods that are “purely black” or white or chinese, etc. would erase all of the historical and social changes that the few courageous men and women have contributed to our societies. I forever hope that this dream of yours will be just that–a dream.
+11Carlos says:
Sunday, October 18, 2009 at 10:27 am
The Problem is that Chinese like most Asians are totally ignorant when it comes to race. Sure, we should all be proud of our racial heritage and culture, having said that. As an Black American who has a biracial child, I know my daughter is beautiful. There is nothing wrong with being Black, White or Asian for that matter. What it boils down to is jealousy. Most Asians are small-minded thinking when it come to race and Blacks in particular. We are are equal. NO asian person would or could ever make me feel inferior, in fact, I laugh at them, because it shows their own pathetic insecurity. How does skin color equate ones intelligence?
So if you are blind and a Chinese person and a Black and White person were in the same room and had to touch each other, there is no way you could ever tell who is who! What makes White skin better? That makes you a better Homo Sapien?
Chinese people hate themselves, it’s a known fact, because if they didn’t, then why do they have to bleach, change their breasts, nose, cheeks etc.? For what? A confident individual would never want to do that. I can see if it is a life-threatening problem, but on the level that Chinese do it and think that the White community will accept them, is so over the top ludicrous! I would never, ever, ever want to be Asian or White. I thank God everyday for making me, me. I love myself a lot. I never hold my head down and have the utter most confidence, because if someone that doesn’t like me because of my color, then that means, they fear me. And that feels good. Stereotypes are sometimes overrated and should not be taken seriously, you good people in every race, but a Black heart, and Asian heart are all the same, if you do an organ transplant, no ever asks, “from which race did this organ come from?” It doesn’t matter. We are all coming together faster than we can think and if China, the growing superpower wants to act in a real sincere and responsible way, then that means, they also need to grow up and understand, the world comes in different colors and races and religions and it’s Ok to be different and that one race is not superior to another. Because if you think that, then that makes you the lowest and most ignorant person, period! I hope more people mix and become one, that way, all this foolishness will stop, but on that point, many Asian countries are still adolescent in that regard. One thing is for sure, when we die, we all go back to being the same….dirt!
+8CL (aka Charles Liu) says:
Thursday, November 5, 2009 at 1:01 am
Cheryl don’t be discouraged. China Smack basically cherry picked the few bad comments to make the story more than it is.
I found these comments from the same KDS thread China Smack cited. There are LOTS of comments supportive of Lou, and against racism. I really don’t know why they are left out:
“不要去歧视外地的,大家都是平等的” – don’t discriminate against outsiders, everyone is equal
“小黑是无辜的” – Little Black [Lou Jing's nickname] is innocent
“这个小姑娘是无辜的,大家积点口德” – the little lady is innocent, everyone watch what they’re saying
“我觉得这个母亲还是很伟大的” – I feel Mother Lou is quite admirable
“小孩很可怜从小被歧视” – poor girl’s been discriminated since little
“以后碰到你身上 你还能噶笃定” – wait til it happens to you, will you be so self righteous
“单身母亲还是要理解的” – single mothers need understanding
“小孩没什么错,大家别这么刻薄” – kids are never wrong, everyone stop being so harsh
“大家不用这么说人家小姑娘吧” – people, there’s no need to talk about her like this
“怎么说她也是讲上海话的土生土长的上海人” – no matter what, she is a local born and raised shanghainese
“何必要这么搞臭人家呢” – why poopoo others like this?
[Note from Fauna: Please do not continue to post comments with different names.]
Nadia says:
Sunday, November 15, 2009 at 3:09 am
are you an idiot??? you definitely sound like one.
It’s people like you that keep the black community down and the world in general.
Become enlightened.
Nella says:
Friday, November 20, 2009 at 2:09 am
Hi everybody,
I just want to say that I didn’t know Chinese were so racists. I’m an African girl who lives in Belgium: I have never seen so many insults on black people in my entire life!!
So what? You think you are better than us?
Just look at your country where you can’t say what you’re want about the government! You are slaves of your president or whatever and his guys..
Many of your people work for almost nothing, you have children who don’t go to school…
You’re think you are better? More beautiful? Come on! Just stop dreaming: if there is a quizz with Black women and Chinese women in all over the world, I bet black women would win…. Don’t misunderstood: before I read all the bullshits I wasn’t thinking of that, but know….
Oh and yes, do you think Black people like you that much? Are you kidding? Just continue to be racist in your country beacause all of you who live in the USA: You have a Black man as presiden, how does it feeLS?
Sorry, but I can’t let it go…
I have to at least write something…
Laura says:
Friday, November 20, 2009 at 5:27 am
I don’t care if you inderstand: I’m just angry!!
C’est quoi ces attaques racistes?
NOn, mais je rêve: vous avec vos pauvres vies, à cause de la souffrance que vous avez causés à cette fille et à sa mère, vous serez jugés!!! Et j’espère que vous aurez l’occasion d’aller rencontrer votre père adoré- le diable- en enfer… Il vous accueillera les bras ouverts…
Vos blagues sont pourries, sans compter le fait que les chintocs n’ont rien de bien spécial ) part un pays qui prend de la place pour rien!!!
Continuez à nous fournir des marchandises à bas prix et des films de combat et fermez-la.
Peu importe ce que vous pourrez faire, vous n’aurez jamais le prestige d’être respecté. Vous garderez toujours votre imege de mains d’oeuvre à bas prix!!
Reply
+8tony says:
Monday, November 2, 2009 at 2:55 am
You people are a complete disgrace , you have Chinese people working in all parts of Africa statements like the above would put Chinese works in Africa in danger, This girl is Goods creation more importantly she is very beautiful
Reply
+6Louisse says:
Friday, November 13, 2009 at 12:52 pm
Its 2009, grow up people things happen in life and love and she is here and she breath’s and has feelings, hold your head up Lou and be proud of your heritage, I am glad you grace our planet and I must say you are simply stunning!
Reply
+25zee says:
Wednesday, September 2, 2009 at 12:09 am
damn china
u racist
Reply
+4R says:
Friday, September 11, 2009 at 8:30 pm
i know right!!? fuuuuuk..
Reply
+3L says:
Wednesday, November 4, 2009 at 5:43 am
it’s insane aye? i cant believe how many racist comments are on here, who cares if shes half black/asian? she’s HOT! (but even if she wasn’t, it doesnt make any difference). AND she’s confident enough to get out there and enter a talent contest.
all of the assholes who think its ok to abuse here because of her mixed race should find something better to do with their time.
AND Cheryl D. Uzamere is just as bad. if you believe that creating a seperate society is the answer then i will tell you now, you are wrong. just because some people discriminate against you doesn’t mean everyone of that race does.
acceptance is the way forward.
just FYI:
mix asian/black/white/whatever = hot
Reply
+81Gaaad! says:
Wednesday, September 2, 2009 at 12:19 am
Igat! As Chinese, I think she’s sizzling hot. Who cares what her mother did. Human emotions and relationships are complicated enough on their own. It ain’t the daughter’s fault and she can sit on my bachelor lap any time.
People need to seriously lighten up. Some of those commentators ought to consider what their comments say about themselves more than anything else about the state of the “morals” of society or what that lovely, beautiful lady should or should not feel or do.
Ye who is without sin shall cast the first stone (or some such). Or maybe bring back the revolutionary self-reflection education classes.
Reply
+4Minna001 says:
Wednesday, September 23, 2009 at 3:27 pm
You took the words right out of my mouth. thank you
Reply
+16Som says:
Saturday, September 26, 2009 at 5:16 pm
Phew! So glad I’m not the only one who thinks she is hot! Damn, Lou Jing!! You should be a model! Don’t let these dumbass Chinese racists get you down. Follow your dreams, and I hope the whole world gets to see more of you.
-An Indian guy.
Reply
+3Thank you. says:
Monday, November 2, 2009 at 5:09 am
Thank you. Finally some evidence of sanity on this crazy fucken forum.
Reply
+1Geegee says:
Wednesday, November 4, 2009 at 1:07 am
One thing to say:
Reply
+1Geegee says:
Wednesday, November 4, 2009 at 1:10 am
http://www.youtube.com/watch?v=VUcNxhGoaEI
Reply
+48Anna says:
Wednesday, September 2, 2009 at 12:21 am
Those comments are unbelievable racist and ignorant. Even though I knew most Chinese are racist towards black people I am still shocked at reading this.
The girl looks beautiful and she shouldn’t be blamed for a mistake her mother made such a long time ago.
Reply
-10Charles says:
Wednesday, September 2, 2009 at 4:31 am
Its important to remember that there’s racism as reaction and racism as a mode of thought. Chinese aren’t necessarily against mixed blood couples; it was the adultery that led to racist comments.
Reply
+59ChinaGeeks says:
Wednesday, September 2, 2009 at 6:35 am
I don’t buy that distinction at all. Racism is racism, so-called “racism as reaction” betrays racist modes of thought. Obviously, the adultery is a factor in the outrage of the commenters, but so is the racial aspect, obviously.
If this girl’s mother had had an affair with another Chinese guy, would we even know about it? Would it ever have ended up on this site? Would people be saying she shouldn’t show herself in public?
These are rhetorical questions, because everyone here knows the answers,
Reply
+4Gaad! says:
Wednesday, September 2, 2009 at 6:45 am
You’ve lost me around the second corner there bro. Waaay to deep for this site me hommie. All I can think of right now is how she’s stirring me Chinese love around and around…… Oh the sweet vertigo….
Reply
+1Yomo says:
Thursday, October 1, 2009 at 11:17 am
You took the words out of my mouth, ChinaGeeks!
if only i could vote for you 100 times!!
Reply
+15Teacher in China says:
Wednesday, September 2, 2009 at 8:07 am
Here’s an example Charles
“I am not racist, but if her mother really was married first and got involved with a black person, then that is indeed low.”
He claims that the big problem is the adultery, but why did he have to mention “black” in that sentence? (I’m always suspicious of any comment that starts “I’m not a x, but…”) I’m not with you on this one at all, I feel there’s still a long way to go before Chinese people are more accepting of African American/Canadian/etc.
Reply
-1Charles says:
Wednesday, September 2, 2009 at 6:34 pm
I agree here that racism is the pivotal issue that entertains this story. However I can also understand the other Charles’s view that most Chinese racism is dormant unless activated by certain situations. In other words, Chinese are latent racists but are good at concealing it.
Reply
+4elaine says:
Wednesday, September 2, 2009 at 8:50 pm
I don’t think any of this makes it look like they’re good at concealing it.
Maybe you mean, they’re racists but they remain passive aggressive about it.
-2Gaaad! says:
Wednesday, September 2, 2009 at 8:59 pm
Ahhh! So that’s what political correctness is for is it? “To conceal it better”. Man, da chinkies need to get themselves some of that fabulocious goodness. Very modern and scientific that, non?
-5Gaad! says:
Wednesday, September 2, 2009 at 9:04 pm
Ahhh, so seems like political correctness is good for concealing racism is it. Man! Da chinkies need to get themselves some of that fabulocious goodness. Very modern and scientific, and very fashionable too, like da people in da West already do, non?
-2Gaad! says:
Wednesday, September 2, 2009 at 9:06 pm
Ooopsala! Double post…me bad. Yikes!
+2Somethin Somethin says:
Thursday, September 3, 2009 at 5:39 pm
accepting of Canadians?
Yeah I’m not racist either, but those Canadians they’re always talking about their Hockey, drinking their Molson, saying eh and being unable to pronounce ‘ou’. Fucken frostbacks.
Reply
+2Teacher in China says:
Sunday, September 6, 2009 at 10:51 am
Frostbacks!! That’s awesome. F*ck Molson, by the way :)
+9mlgb says:
Wednesday, September 2, 2009 at 11:02 am
Bollocks. What about all the comments that make no mention of the adultery and simply say things like: Ugh. Yellow people and black people mixed together is very gross.
It’s racism pure and simple. It’s not the violent, KKK burning crosses on your lawn style of racism, but the far more insidious kind that holds that black people are somehow dirty or lower than others due to the color of their skin.
Reply
+10Uranium Willy says:
Thursday, September 3, 2009 at 8:17 pm
I agree with you totally. The type of racism that happened, and still happens to some degree, in the US is of the type where there is some balance, where a large percentage of people who are white find it appalling and blacks have some say in matters and over time affect changes on the culture.
The racism here in China is so ingrained that people here are not even aware of it. Look at what the netizens here had to say about Condolezza Rice when she came here. Lowest forms of insult. Ignorance. Yet Chinese people will always deny that they are racist. Look at the US Olympic team and the Chinese Olympic team. Did you see one black person on the Chinese team? One white? One brown? And if China had let a black runner on the team what do you think the national response would be? ugly racist remarks like this. And further more, these poster have no shame, no ability to +
My 1 1/2 cents
writing. Even the shit that comes out of my ass has a higher intelligence than you.
Reply
-3jeffy says:
Thursday, September 3, 2009 at 11:09 pm
To hell with your comment you fucker of racist.all this balck doing great around the world are droping from heaven? are they not from Africa.How about your morthan day genocide.All you need in Africa is there resources and exchanges it for Arms.color is color!the worst you commited in the world is morthan any black.you can cover up your bad deed and opens others.Beside you peoples means nothing to Africa and expect and just mother fucker racist.
Reply
-22hellofriends says:
Friday, September 4, 2009 at 2:17 am
[comment hidden for too many negative votes -- click to view]
Chinese men have larger dicks than white men, and it’s already been scientifically proven-
Blacks have small dicks if you count the fact that half of them are starving, 50% of those who are not have AIDS, and pygmies.
Reply
-1chinoXL says:
Saturday, September 26, 2009 at 9:20 am
please display this research, to promote our cause. Because when in the sauna, this is not so…they cannot find yours
Reply
Nadia says:
Sunday, November 15, 2009 at 3:17 am
didn’t mean to vote positive! you suck hello friends!
Reply
+2Valen says:
Friday, October 30, 2009 at 2:38 pm
J, please inform yourself. Where are you getting these statistics from? That more blacks than whites are not given parole or are given stricter sentences for the same crime seems to skew these statistics. I did a report on crimes in America, from thefts, to rapes, to murder. More blacks are convicted of smaller crimes but are given longer sentences versus their white counterparts. Blacks are being marginalized more in the US, which again plays to the racist tendencies of a bigoted country. If only the rest of the world would learn from America’s mistakes and not repeat it.
Again, please inform yourself before throwing random stats and proclaiming them as fact.
Reply
+2blk gai says:
Tuesday, November 3, 2009 at 12:06 am
J says: Americas, roughly 70% of all convicts in the US are blacks and 70% of all black males ages 21-27 have been or are currently in jail. I haven’t even touched the tip of the iceberg here.
In reality, ” About 10.4% of all black males in the United States between the ages of 25 and 29 were sentenced and in prison, compared to 2.4% of Hispanic males and 1.3% of white males.”
A disproportionate amount of black males are in jail, but it’s no where NEAR what you’re saying. In fact, the majority of prisoners are white.
In fact, the majority of black prisoners (and prisoners in general) are in jail for drug related non-violent crimes.
I sincerely Hope that Helps, Retard.
Reply
Nella says:
Friday, November 20, 2009 at 2:15 am
Hey you,
what are you talking about?
Forgotten the students who had been killed in China?
Mao? AND ALL THE STUFF? ComE on… Don’t think China is an exemple…. Don’t!
Reply
-8Ming says:
Wednesday, September 2, 2009 at 7:22 pm
No offense, but:
3) Black people are the lowest of the low in social ranking internationally. This is largely due to the political and economical situation in Africa.
One of the reason that this story cause so much reaction on the Chinese forum, is that Chinese people believe in “marrying upward”. Which is why if the father have been a white guy, this story would not cause so much reaction. But the fact that her mom cheat with a black man, it makes Chinese wonder: why?
I have no opinion on this story, I just want to clear out your confusion.
Reply
+2Gaad! says:
Wednesday, September 2, 2009 at 9:19 pm
Ya, I’m all clear now.
Reply
+6Fred says:
Thursday, September 3, 2009 at 10:20 pm
@Ming
I agree with you. The low social, economic, and cultural level of blacks in Africa contribute to people having a low opinion of blacks. Until the African/black political and business elite clean up their act, their people will always be looked down upon.
This situation of looking down on Chinese by whites also existed in the US. Chinese were considered weak, dirty, and uncivilized.
It was only after Chairman Mao established the PRC did the white world realized that the Chinese now knew how to fight and could not be bullied any more.
(This same thing applied to the Jews. They were once consider weak and dirty and despised by everyone. But once the Jews established the state of Israel and fought several wars and defeated the Arabs, the world realized the Jews now knew how to fight and would not be bullied anymore.)
In the US, it was against the law for a Chinese to marry a white person until 1967.
When Bruce Lee married a white woman, many whites made disparaging remarks about a white woman marrying a Chinese, just like the comments directed at this young black girl’s mother.
Irony of ironies, the US had several Chinese communities in the South where Chinese men married black women because of the restriction on Chinese women entering the US. Today, there are many “black Chinese” descendants from those relationships.
http://www.oah.org/pubs/magazine/asianamerican/vivian-wong.html
Tom Bradley, the five-times elected mayor of Los Angeles, is of black Chinese ancestry.
http://books.google.com/books?id=JBiB_Mzsa2kC&pg=RA1-PA134&lpg=RA1-PA134&dq=black+chinese+texas&source=bl&ots=RNQqT92qbJ&sig=-_tiljgUoqOr0Fw8QIpaO1zpOe0&hl=en&ei=EcqfStuoHYiO6AOA3pzwCw&sa=X&oi=book_result&ct=result&resnum=8#v=onepage&q=&f=false
It’s amusing and pathetic to read the ranting of the ignorant and the stupid. This is the drawback of democracy and the internet.
I’m glad you didn’t participate in this stupid discussion.
Reply
mimi says:
Sunday, September 6, 2009 at 5:28 am
but do you know what african or black think of you by calling them low, your an idiot your high right in which case just tell how higher your?
Reply
mimi says:
Sunday, September 6, 2009 at 5:31 am
ATLEAST FRED YOU TALK WITH POINTS BUT NOT MING
Reply
+4mislin says:
Monday, October 19, 2009 at 11:47 pm
Yes. I do believe that in hierarchical Asian countries, the whole world is ranked from top to bottom. No one wants to associate with ranking below one’s own.
This is a drawback for many Asian countries. It promotes outrageous racism. Also, it exacerbates superiority and inferiority complexes. That is how oppression works.
So, coutries that rank higher are constantly chased and there is a great feeling of inferiority towards them. Hence, the better looking white woman lead Asian women to perform ridiculous surgery on there eyes so they are not slanted. Absolutely ridiculous. Now, for the coutries that rank below, people feel self-righteousness and a superiority that they are better.
Their system is their own private hell. Misguided superiority and exaggerated self-hatred tug them at both ends. I hope the rest of the world isn’t headed in this direction.
Next, there has been a discussion of black people in prisons. Think about it. People who have to deal with this type of racism for no reason other than skin color, how would you be if unfairly treated this way.
The best situation would be to take the racists of the world and isolate them on another planet. Then they could drive each other insane with their hatred. After all, people like that deserve each other. They could rank themselves there.
Reply
-4martin says:
Monday, September 28, 2009 at 8:39 am
It is manifestly untrue that internationally, blacks are held in higher regard than Chinese. I cannot think of anything more false, in fact. How can anyone think that ? It seems that someone who has never set his foot outside China is allowing the Hollywood media to shape his opinions.
Chinese: law abiding, intelligent, self reliant, hard working.
Black: Put “not” in front of each of the above.
Reply
jay says:
Sunday, October 18, 2009 at 3:49 am
ChinaSmack should just take comments like these off the site, not “hide” them and allow a simple click to reveal its contents.
Reply
James says:
Tuesday, November 10, 2009 at 1:00 am
You are soooo… right MJ. She does look better than most Chinese women. Some black man with money needs to go and get here and take her away from all the haters over in China. I bet she will make beautiful babies of her own. I also believe that her mother just wanted to experience what it would be like to be with a black man. She didn’t want to leave her husband.
Reply
+11Gaaad! says:
Wednesday, September 2, 2009 at 12:41 am
Btw, in the Caribeans there are lots of people with Chinese surnames, being descended from inter-marriages between black women and Chinese men, like Edouard Wah or Naomi Campbell. Then there is Jean Ping, the Chairperson of the Commission of the African Union.
With China’s increasing role in Africa, there is likely going to be even more mixed race children. So welcome to the gene pool, especially if they are as hot as Lou Jing. Or Fabulocious! as they say in Jamaica.
Reply
-10Oli's Shanghai Blog says:
Wednesday, September 2, 2009 at 12:50 am
You mean to tell me her despicable mother didn’t even buy her an parasol after she was born? Shameless.
Reply
+4W76 says:
Wednesday, September 2, 2009 at 12:52 am
I really don’t understand why Chinese always talk bad about the Japanese, Korean and vice-versa because it seems to me that they have the same mindset, to keep the race pure and don’t breed any mutts… to hell with that racist shit! racist people are the lowest piece of shit! Biracial children are just as beautiful!
Reply
+13Gaaad! says:
Wednesday, September 2, 2009 at 1:04 am
Eh…OK lets generalize all 1.3 billions+ Chinese shall we. Man! Christ on a stick, some of the comments here are as bad as those above about Lou Jing. Lighten up peeps! Spread da LOOOVE!
Or better yet, let me spread me looove all over ya…
Reply
-4Gaaad!'s GAY lover (Fike2308) says:
Thursday, September 10, 2009 at 9:07 pm
Come back to bed baby and spread your love all over my anus…..
Reply
-1Gaaad! says:
Saturday, September 12, 2009 at 11:30 pm
*sniggers* Quel q’un douche est muy sensitivo. Was fuer ein Arschloch! LOL!
Reply
+13HK says:
Wednesday, September 2, 2009 at 12:54 am
Tiger Woods is black / Thai. Kimora Lee Simmons is black / Japanese and was modeled for Chanel in Paris. Tyson, the male model, is black / Chinese.
Since when was it “common knowledge” that Asians and blacks make “gross” babies?
I was at a conference overseas and some (embarrassing) fellow Chinese kept standing up to condemn American “hegemony.” Had no idea what the h*ll she was talking about.
Americans have long embraced difference. It’s the Chinese who insist that everyone is the same! One race, one country, one Party…
I hope these comments are from crazies on the fringes of society, and that the average mainlander is not this ignorant and racist.
Reply
+3Oli's Shanghai Blog says:
Wednesday, September 2, 2009 at 1:06 am
Tiger Woods is black?!??!?!
Reply
+8Gaaad! says:
Wednesday, September 2, 2009 at 1:08 am
NO…he’s a rainbow because the sun came out after his mummy and daddy made lots of rain…
Reply
+12whichone says:
Wednesday, September 2, 2009 at 1:26 am
I think he is like a quarter black or something.
I read comments above from Tianya and netease and I feel ashamed of my fellow Chinese people. Not to make excuses for them but even for America, arguably the most diverse and open country in the world has had lots of problems with racial conflict/discrimination, and China is much more monolithic when it come to race with ~90% Han and probably 99% Asian population. It’s easier to discriminate when no one knows anyone from a different race.
and btw she is smoking hot!
Reply
+9Panic! says:
Wednesday, September 2, 2009 at 1:59 am
“Ohmygod! A black person on Chinese TV! I can’t accept this modern society! Help me!”
Just kidding. Those comments crack me up.
Wikipedia: Woods is equal parts Chinese, Thai, and African American. But whatever.
w76 — you’re totally right! How many Chinese descent from concubines, or mistresses that cadres keep in “second houses”? People are naive if they think everyone on TV comes from some pure background.
Reply
+6Kellen says:
Wednesday, September 2, 2009 at 8:05 am
he’s 1/3 thai, 1/3 chinese and 1/3 black? i mean, i can see how mathematically that could happen, but it strikes me as a little unlikely.
+5whichone says:
Wednesday, September 2, 2009 at 9:38 am
LoL Kellen
Since a child always comes from two biological parents, one can only be portioned into traditional categories of race with denominators in the powers of two.
what Panic! meant is that tiger woods is equal percentage (25%) of thai, chinese, and black, but that’s not all he is, evidently he is also 1/8 native american and 1/8 dutch.
There is a pretty interesting article on his race defined in a multiracial america.
From Salon.com
http://www.salon.com/april97/tiger970430.html
+5Teacher in China says:
Wednesday, September 2, 2009 at 8:13 am
Yeah I agree with you, every country has problems with race, but I find it worse in China regarding black people. I saw these wall hooks for sale in the supermarket a few years ago with little pictures on them – cartoon versions of black people with hugely frizzed out hair, massively puffed out lips, dazed looks in their eyes and bones through their noses! As many problems as the west has with racism, that would never fly in a normal supermarket over there.
Reply
+4Gaad! says:
Wednesday, September 2, 2009 at 9:40 am
Duda, chill man, lighten up. It’s call comics, caricatures, exagerated imageries whatever. Life would be pretty boring if you take the pc crap too far without considering the context.
I mean seriously, imagine no manhua/manga, Disney, Marvel, DC or Dilbert. Life just ain’t the same.
+1Teacher in China says:
Wednesday, September 2, 2009 at 1:23 pm
I like your laissez-faire attitude Gaad, you seem like a fun guy. You’re pretty off base to compare the picture I described to manga, disney and dilbert though.
+3Gaad! says:
Sunday, September 6, 2009 at 6:33 am
Ahhhhh!!! I sooo like you too Tic. Let’s all hold hands and sing Kumbaya and have a lovefest now shall we?
deltaforce says:
Sunday, September 6, 2009 at 2:52 am
Yeah, Tiger Woods mother is Thai and his father is black African-American.
Reply
-4Eric says:
Friday, September 4, 2009 at 1:39 am
what are you smoking?
America created institution of racism. Maybe you should read some history at how USA treated asians and chinese
America hegemony is disgusting
Reply
+5Noele says:
Friday, September 4, 2009 at 12:32 pm
Racism was around long before the United States of America was founded.
Perhaps you should read a history book, dumbass.
Reply
+1Teacher in China says:
Sunday, September 6, 2009 at 10:57 am
“America created institution of rascism” – that has to be the stupidest comment I’ve ever read anywhere in my whole life. You’re not Eric Wong / Smickmo by any chance are you?
Reply
-6Wretchedofthepond says:
Saturday, September 26, 2009 at 7:42 pm
Ok, Joke-time is over. I’ve seen comments comparing people to animals (some of which I’ve written) — and THAT was the stupidest comment you’ve read anywhere in your WHOLE LIFE? Based on the fact that you are possibly a Teacher, you yourself take prize for stupidest comment. We all know that America was the first to industrialize the institution of racism. This gross indecency in Chinese thought, I speculate, would not exist at this level without Western mass media’s teaching prowess. There were racialist institutions, that’s a given — but the filth of China is of such a gross and cookie-cutter magnitude as to suggest an offshoot of the American “phenomenon”.
Reply
+6jay says:
Sunday, October 18, 2009 at 4:03 am
“We all know that America was the first to industrialize the institution of racism.”
Firstly, who is “we?” You, and who else? The US WAS NOT the first society of people to enslave others. You are saying that the US, a nation not even 250 years old created the “institution of racism?”
The institution of slavery is the beginning of the “racist institution” you speak of. Racism, then, can be traced all the way back to 1760 BC. In the Code of Hammurabi, slavery was clearly part of the Babylonian civilization. Slavery also traces back to the Sumer, ancient Egypt, ancient Greece and ancient Rome.
Where are you getting your historical information from?
+3Fike2308 says:
Sunday, September 6, 2009 at 11:21 am
Racism is older than America.
Reply
+9Gaaad! says:
Wednesday, September 2, 2009 at 1:16 am
Btw can’t ChinaSmack translate some of the supporting comments on the Oriental Angels website too for a more balanced view. Tata and cheerio matey.
Reply
FYIADragoon says:
Wednesday, September 2, 2009 at 1:28 am
Oh boohoo, look at us the poor Chinese who have everyone being racist against us. And when we get the chance, what do we do? Be just as racist, if not worse. Goddamnit their level of hypocrisy goes beyond childishly excusable sometimes.
Reply
+2Gaaad! says:
Wednesday, September 2, 2009 at 1:42 am
Oh Mon! Looksy like I need to spread some of me precious Chinese love all over you too eh?
Reply
-5hellofriends says:
Friday, September 4, 2009 at 2:21 am
Yeah because Chinese people are to blame for the Holocaust. Chinese people are to blame for genocide of Native Americans. Chinese people are to blame for lynchings, Jim Crow, church burnings. Chinese people are to blame for the annexation of Texas and California. Chinese people are the ones occupying 100% of the world’s best land and 30% of the world’s total land mass.
Get a clue idiot.
Reply
Fike2308 says:
Friday, September 4, 2009 at 10:34 am
Chinese people are to blame for the Cultural Revolution, The Great Leap Forward, The Tianmen Square massacre of 1989, etc.
Reply
+2Gaad! says:
Sunday, September 6, 2009 at 11:18 am
U forgot to blame Chinese people for yourself too.
Reply
Fike2308 says:
Wednesday, September 9, 2009 at 7:50 am
Blame Chinese people for myself?
What does that mean?
I’m not Chinese.
-1Gaad! says:
Wednesday, September 9, 2009 at 9:01 am
Are u sure? Are u very, very, very sure? Go do a DNA test fer u’ll find it most illuminating.
-1rayfish says:
Sunday, September 6, 2009 at 5:43 pm
glad to see u recognise that not even 1% of china is not a dump
agreed
Reply
+31W76 says:
Wednesday, September 2, 2009 at 1:43 am
So, Lou Jing’s mother bore her lover’s child, she isn’t the first woman to do that and she won’t be the last.. on the other hand, she should be praised for choosing life and raising such a beautiful biracial daughter in a homogenous society while having to face being stigmatized. I can’t even begin to imagine all the racial slurs, disaproving looks and evil gossip she and Lou Jing must have faced on a daily basis. I commend this brave and proud woman. She did a mighty fine job of raising her child to become a beautiful, young woman despite all the hardships they must have faced and will continue to face through out their life.
Reply
+5Patrick says:
Thursday, September 3, 2009 at 8:21 am
Hear, hear. How many generations before we get common thinking like this here?
Reply
-1Chinosophy says:
Wednesday, September 2, 2009 at 2:07 am
Heavy metal is the law.
Lou Jing’s skin-colour is approved. Black is metal.
Lou Jing’s music is not approved. It is pink and ugly.
Read about crabcore and China at http://chinosophy.blogg.se/
Reply
Hell says:
Wednesday, September 2, 2009 at 2:20 am
Welcome to Hell, every one.
Reply
-2warped0ne says:
Wednesday, September 2, 2009 at 2:28 am
The LACK of racism in this country is amazing. I might just live here for the rest of my life because I absolutely despise the completely racist Western country I originate from.
If you don’t get the sarcasm in this post, turn off your computer, go to the bookstore/library, read a f’ing book and learn something.
Reply
-7joe says:
Wednesday, September 2, 2009 at 2:52 am
Most black guys are incapable of maintaining long term relationships. I’ve seen it happen a million times. They stay with a woman until she’s pregnant and then there on to the next one.
Reply
+12black guy says:
Wednesday, September 2, 2009 at 8:55 am
Most people like you suck a lot of dick and like to give rim jobs to down and out people who haven’t washed their asses for decades.
Been married for 20 years. Have 4 brothers all in similar long term situations. That’s 5 out of 5. Your statistics are pulled right out of one of your homeless lover’s asses
Reply
+9Gaaad! says:
Wednesday, September 2, 2009 at 11:34 am
Woah! Easy there friend, angry black man stereotype to the fore. Let’s not feed the buggers any more than their puny little diencephalon can handle.
Reply
-2Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 7:51 am
I like you Gaad! You and I have much in common.
Let’s hang out and suck each other’s dicks while we light firecrackers and talk about how much we love China.
Reply
+2J says:
Wednesday, September 2, 2009 at 10:58 pm
So what about the fact that 60% of African Americans grow up in single parent families? Or perhaps the statistics of drop outs/under age pregnancy that happens in the US with African Americans?
The truth of it is that I don’t hate blacks. I have very close black friends. However, we must face reality and deal with these social problems that the African American culture has.
Not saying that other ethnic groups in the US and around the world don’t have their own set of problems. It’s just different sorts of social issues from those of blacks.
Reply
+7black guy says:
Thursday, September 3, 2009 at 5:31 am
The fact is the young black males of which you speak have not run off to get some other girl pregnant. They are in prison. In the united states they privatized the prison system. Those running the prisons can not make a profit unless they have criminals to put in their jails. Corruption and jailing of blacks is rampant. If someone makes a profit based on how many black asses end up in jail guess what happens next…..
http://www.cnn.com/2009/CRIME/02/23/pennsylvania.corrupt.judges/
If you are really into statistics check out the justice department figures which show black people routinely get jail time for minor crimes that whites wouldn’t even be arrested for.
Reply
+10Medentze says:
Saturday, September 5, 2009 at 11:37 am
ROFL.
Because having black friends suddenly makes you immune to racism.
/end sarcasm.
Get a clue. It’s not “African American culture” dipwad, it’s the effect of generations of economic, social and political dis-enfrancisement and INSTITUTIONALISED RACISM.
I will give your ignorant arse a moment to look those terms up.
Reply
+5Valen says:
Friday, October 30, 2009 at 2:43 pm
Again, here you are mouthing off without backing it up. Please unfriend your black friends because you are clearly learning nothing from that which informs this discussion.
I’m with black guy below. INFORM YOURSELF and STOP LOOKING LIKE AN ASS.
Reply
+1Nadia says:
Sunday, November 15, 2009 at 3:25 am
“I have very close black friends” sounds like an explanation given by an undercover racist.
Reply
+10A says:
Wednesday, September 2, 2009 at 11:39 am
YOu’ve seen it happen a million times huh? you must be very old and experienced. Where do you even think up things like that. “most black guys” is it really that easy to generalize? Has a white man never left a pregnant woman to fend for herself? you associate “black” with a poor sense of responsibility. In fact, it’s a personal decision. Are you saying these men leave their partners because they are black? Does being black make you inherently likely to run away from your child? I wonder what gene determines that.
Reply
-8joe says:
Wednesday, September 2, 2009 at 1:04 pm
My exwife is black thats why I know so much about it. Steve McNair is a good example of this, only his girlfriend wouldn’t put up with it.
Reply
+4Medentze says:
Saturday, September 5, 2009 at 11:43 am
There’s a good reason, I assume, that your black ex-wife is your EX. I wouldn’t want to live with a spouse that views my race as irresponsible, unintelligent and all-around bad.
In reality, you know nothing about the black condition, in the States or elsewhere.
Reply
+4Gaad! says:
Saturday, September 5, 2009 at 12:57 am
My ex-biatch’s name iz joe and me best homeboy’s name iz joe too. And you’re a tool too, tool.
Reply
-1Hell says:
Wednesday, September 2, 2009 at 3:04 am
So fucking PC in west about black. But regarding Chinese, they show no hesitation about their racism. Fucking Cowards.
Reply
-2VeerLeft says:
Wednesday, September 2, 2009 at 3:40 am
Come see me. Seriously, I have no racism in me, but I also won’t accept your shitty attitude.
Reply
+6Gaad! says:
Wednesday, September 2, 2009 at 6:48 am
And I’ll just show you my love.
Reply
-1Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 7:53 am
I want Gaad! to blow a WAD of his “love” in my tight, yellow butthole.
I want to feel all two inches of his boner in my Chinese ass!!
JIA YOU!!
Reply
Nadia says:
Sunday, November 15, 2009 at 3:30 am
you are a true 白癡
+8e^e says:
Thursday, September 3, 2009 at 1:17 am
Oh please, people only show PC in public. Look on the net at youtube comments, SomethingAwful forum, and 4chan. Same type and intensity of racist comments.
This is the internet, there’s no real life negative consequence when one makes a racist remark so it’s a free-for-all. Heck read through this and other Chinasmack comment sections, half of the comments here discussing racism in China are racist.
Reply
-1chi says:
Tuesday, September 22, 2009 at 10:27 pm
your examples suck. youtube commenters are known for being bottom of the barrel knuckle-dragging mouth-breathers. 4chan racism is a joke. and as a goon, i know somethingaweful does not tolerate racism. i’ve seen people perma-banned for it too many times.
Reply
-8BeWay says:
Wednesday, September 2, 2009 at 3:13 am
I will think the criticism arises due to the fault of her mother. If her mother will to marry a black when she is still single, I believe the issue on the color of her kids will not be subjected to any ugly discrimination. The moral story of the whole article is that Asian society as a whole, is not willing to change to open society as compared to the West. It has nothing to do with Chinese as rascists.
Reply
+4VeerLeft says:
Wednesday, September 2, 2009 at 3:46 am
There are TONS of kids here born from EXTRA marital affairs. There are tons of extra marital affairs here, so what is the issue? Oh, that it was made obvious by her abnormally well toned skin and perfectly proportioned body?
These KDS fags can rot in hell… making ridiculous amounts of totally ignorant remarks about a situation that they don’t understand. Most of them are trying like hell to cultivate their first pube and they dare to castigate this woman and her daughter? Fuck them.
New Mission of the week, I am gonna find me a married Chinese bird and fuck her pockets empty.
Reply
+2Gaad! says:
Wednesday, September 2, 2009 at 6:50 am
Wooo! Can I please come along? Please? Please? Pretty please, with lots of cherries on top?
Reply
-2poor thing says:
Thursday, September 3, 2009 at 3:13 am
And I, will pay. First treats on me gentlemen.
Reply
+3Gaad! says:
Sunday, September 6, 2009 at 6:36 am
Uggghhh!!! Some hommie simply don’t know the meaning of irony….
Reply
-1Ras says:
Tuesday, November 3, 2009 at 6:43 pm
That’s right bro I think it’s time I went back to Africa and organise a political party that’ll kick all the chinese men out and leave their woment there to inter breed.
Reply
+22MiaoMiao says:
Wednesday, September 2, 2009 at 3:49 am
@ Hell — Oh please. I’m Chinese and grew up in the U.S. Except for a few schoolyard taunts, there was NO racism against me or my family. Not at school, not at finding a job, not at making friends, not at dating — nothing. My dad’s American company even paid for him to improve his English with a tutor.
Actually, I think racism is worse against blacks than Asians in America. We’re just known as being good cooks and being good at math! Asians generally fare pretty well in the U.S.
Talk to mainland Chinese though, and they are FULL of racist thoughts. Laowai are like this. Blacks are like that. Mixed-race are like this. So judgmental. Just like you.
The only “racism” I experienced was when I met a group of Chinese students at a U.S. college and they yelled at me for bringing a blonde friend to the table. They said “no foreigners can sit with us!”
Reply
+11Panda says:
Wednesday, September 2, 2009 at 10:54 am
So true. Mainland Chinese people are hella racist towards black people. It not they racist cuz they are just mean people, but they just don’t know any better (i.e stupid) They think they are either poor, stupid or a thug.
Reply
+2poor thing says:
Thursday, September 3, 2009 at 3:16 am
all of thats because you’re a girl.
Reply
+3Eric says:
Friday, September 4, 2009 at 1:42 am
you should look at US media more closely or better yet read US history at how chinese were treated
Reply
+5Shocked and Saddened says:
Friday, September 4, 2009 at 7:06 am
yes and look at how white americans treat black people and study the 400 years of slavery that african americans went through.
both black and chinese people have been victim to racism so why turn on black people instead of uniting against racism?!!!
Reply
-7Fike2308 says:
Sunday, September 6, 2009 at 11:24 am
“…400 years of slavery that african americans went through.”
Wait, are you saying that slavery in America is 400 years old because America isn’t even 300 years old yet.
Reply
-1rayfish says:
Sunday, September 6, 2009 at 5:22 pm
yeah cuz racism is done by white peeps against white peeps huh shit4brains?
Reply
+3Medentze says:
Saturday, September 5, 2009 at 11:48 am
Simply because the Chinese were treated poorly by US Americas does NOT give the Chinese a free pass to be racist against ANYONE. Are you justifying hatred on the grounds of being hated?
Reply
+5Gaad! says:
Sunday, September 6, 2009 at 6:38 am
Yeah, everybody has a chip on their shoulders, so what’s new?
Reply
Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 7:54 am
Yeah, and our Chinese penises are only 2-inches long so of course our Chinese men have chips on the shoulders!!
anne says:
Tuesday, November 3, 2009 at 6:05 pm
School yard taunts don’t count as racism? Seems like you’ve been living with a paper bag on your head. Americans try to keep a visage of PC but it is very much there.
Mainland chinese can be racist, so can Koreans and Japanese. My black friends have told me they felt most discrimminated in Korea and how many countries have you come across that have a “no foreigners” sign allowed legally outside their stores? Japan being one of them. Comments about Laowai this, blacks that are not “racist” they’re called racial prejudice. People like that are are either ignorant or hicks who were brought up without knowing better. Racism is when you think your race is superior to another. And actually there is a conception among chinese that mixed race people are usually more intelligent…The more mixed the smarter. judgemental? yes, racism? Sometimes.
Reply
-5Wil says:
Wednesday, September 2, 2009 at 4:05 am
Imagine if the Chinese father accepted his biracial daughter openly. Would Chinese people be even more racist? I would admire his courage and love. But what he did was logical. Poor Lou Jing. Shame on the mother. I hope her biological father trips on a gun while robbing a gas station and gets a bullet in the gonads.
Reply
+1CR says:
Wednesday, September 2, 2009 at 4:07 am
I’m bookmarking this page. Whenever I think there is hope that I can understand Chinese society, and the differences aren’t insanely vast, I will reread the Chinese comments.
Reply
+15Stuey says:
Wednesday, September 2, 2009 at 1:16 pm
Why do the differences look so vast? The Chinese racist and bigoted comments look pretty much the same as Euro/American racist bigoted comments: fear of the presumed sexual power of black men, worrying about the purity of the race, viewing black people as uncivilized or criminal… I can’t see anything here that shows a uniquely Chinese version of racism. Anyone from a European culture who thinks this is incomprehensible and alien has (a) a poor grasp of history, (b) a short memory, and (c) the good fortune not to have seen many comments on sites like youtube.
Reply
+1Shocked and Saddened says:
Friday, September 4, 2009 at 6:59 am
yes i agree this is not the same type of racism as the white Americans against black and hispanic people. However, this is still a different type of racism and the ignorance of these racists must be addressed. As knowledgable people we must educate those niave racists about other cultures so that these views maybe changed.
I am a black europeon of Chinese, Caribbean and south american decent. I admit there is rascism all around the world in different forms and extremities. I am lucky enough to live in a city where there are many cultures and where the goovernment do a lot to limit racism and educated the ignorant.
Please people! GO OUT AND LEARN ABOUT DIFFERENT CULTURES!
Reply
+1ChinaGeeks says:
Wednesday, September 2, 2009 at 4:35 am
You guys are all crazy. These people aren’t racist (there’s no racism in China), they just hate black people is all.
Reply
+3ChinaGeeks says:
Wednesday, September 2, 2009 at 4:35 am
…and a follow up for the slow: that was sarcastic.
Reply
the great yellow master race says:
Wednesday, September 2, 2009 at 4:51 am
yeahh its in blood and tea!
Reply
+2Gaad! says:
Wednesday, September 2, 2009 at 6:53 am
No, it’s in da love juice. Want me to show you mine? You’ll like it very muchy, I promise.
Reply
-1Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 7:56 am
Gaad! is so funny and clever. His comments give me a happiness in my trousers.
Come blow your love juice in my gay, Chinese mouth but make sure you have enough for my boyfriends too!
Reply
+6Yin says:
Wednesday, September 2, 2009 at 4:45 am
Chinese people are indeed racist but currently, at least, nothing beats the number of white anti-miscegenation websites on the web. I took some time to browse through that circle of blogs and MAN, do they hate other races (esp. blacks and Hispanics).
Reply
-2the great yellow master race says:
Wednesday, September 2, 2009 at 4:51 am
how can you compare this?
Reply
Fike2308 says:
Sunday, September 6, 2009 at 11:26 am
I’m white and I have a ton of Spanish friends.
I don’t know a ton of black people but most of the ones I’ve met were cool.
Reply
-4rayfish says:
Sunday, September 6, 2009 at 6:24 pm
that’s coz we r superior and rich and we invented the internet
if u dont like it dikwad , y dont u leave lol
Reply
dave says:
Wednesday, September 2, 2009 at 5:00 am
Dave Chapelle was smart he married a filipina.
Reply
+3Fike2308 says:
Thursday, September 3, 2009 at 10:40 am
I love the Dave Chapelle sketch where he’s a blind KKK member.
Reply
12meeeeeee says:
Wednesday, September 2, 2009 at 5:06 am
lawl,
china is the most racist place i have ever been to.
that this article is passed of as NEWS, is a fkn disgrace.
keep pretending this is shocking guys.. its just normal in china.
Reply
-1hellofriends says:
Friday, September 4, 2009 at 2:24 am
Call me once you see a lynching in China. Until then, stop whining.
Reply
-3Fike2308 says:
Friday, September 4, 2009 at 10:39 am
Why does it have to be a lynching?
How about someone being shot with a gun?
Did Mao Zedong say something about “political power comes from the barrell of a gun” ?
Reply
-1whatever says:
Wednesday, September 2, 2009 at 5:56 am
Racist? The chinese didn’t import blacks to the new world like herd animals. They didn’t break the front teeth of black slaves to force feed them liquid and keep them from suicide. The chinese didn’t exterminate the native americans in both North and South America, and practically the aboriginals in Aussie. The chinese didn’t rape, pilfer and burn the non-western world in their quest for domination and natural resources. Having built the railroads and mined for minerals, the western and aussie countries then expelled the chinese and signed chinese specific exclusion laws. If the chinese are racist, then I guess it takes one to know one.
The mother is a tramp period. What else do you call women who has an affair. The father is a lowlife scumbag. I wouldn’t have any beef with the daughter, her being born is not her fault. However, it is my beef when she uses her blackness to get notoriety. If you’re going to play that game, then don’t be surprised if you get burnt from the other side of the coin.
And all this PC black love in the western world is just the current hollywood/media fad flavor of the day. Of course, hollywood and the media runs a massive trade in racism and ignorance.
Reply
+9Gaad! says:
Wednesday, September 2, 2009 at 6:24 am
While I have no lamb chops with your first paragraph, but following on from your second paragraph, do you expect the girl to hide her face under a hoodie all her life? And how exactly do you know she is using her “blackness to get notoriety”, oh my sweetie pie?
Is the media-entertainment industry not a valid occupational choice for a black-Chinese gal or does blackness automatically equates notoriety in your mind? Dude you need to unzip your pants more often and live a little. Now go love a sista. I for one welcome her addition to the Great Chinese gene pool, oh yes…
Reply
+8ChinaGeeks says:
Wednesday, September 2, 2009 at 7:11 am
Ah yes, respecting black people — just a fad!
Sorry to interrupt your self-righteousness, but just because China didn’t enslave black people doesn’t mean Chinese people can’t be racist. The US didn’t force thirteen year old girls into marriages for money and bind their feet until the bones cracked and bled, but does that mean only Chinese people are misogynist?
(Hint: the answer is no.)
Also, I wonder how she is “using her blackness to get notoriety”? By going on TV and revealing that she is half black?
Reply
-5hellofriends says:
Friday, September 4, 2009 at 2:26 am
And just because you’re an obnoxious whiteboy parasitizing China and abusing white privilege it means you can lecture more progressive people on race?
No.
Reply
-1Medentze says:
Saturday, September 5, 2009 at 11:56 am
LMAO.
“More progressive?”
Did you even *read* the comments directed at that girl? Ring me up once China actually progresses, k?
And just because your a self-righteous nationalist tool devoid of empathy and racial intelligence (read: not racist), does it mean you can lecture “obnoxious whiteboys parasitizing (LOL, I love how you used creative verbage on that one!) China and abusing white privilege lecturing your (noticeably less) progressive people on race?
By god, no.
Reply
+2Gaad! says:
Sunday, September 6, 2009 at 6:47 am
Heh?! Non comprendre was der Kerl parler la. Can somebody 翻译 per favore und mucho obligato.
-3rayfish says:
Sunday, September 6, 2009 at 6:28 pm
probably her ceing black revealed it on the television. i mean call me a rocket scientist and i didnt even watch the (s)ho
Reply
-2Teacher in China says:
Wednesday, September 2, 2009 at 8:30 am
Dude, seriously. The slaves thing (as well as most of your other examples) was CENTURIES ago. We’re talking the here and now, present day.
Reply
+6the great yellow master race says:
Wednesday, September 2, 2009 at 2:09 pm
lol. slavery in China was officialy banned first in 70′ens. together with ceremonial canibalism and human sacrifice.
Reply
-3Fike2308 says:
Sunday, September 6, 2009 at 11:28 am
Well, that sounds like progress to me.
Reply
-1Josh says:
Wednesday, September 2, 2009 at 10:29 am
yeah, because fads always last for 45 years. the rest of what you wrote is just more of the ever present, fenqing banality: strawmen to distract the reader from the original topic.
“Your shoe is untied.”
“Yeah?! WELL YOU’RE UGLY!”
Reply
+1AndyR says:
Wednesday, September 2, 2009 at 11:17 am
Chinese kept slaves for centuries, just because (most of them) weren’t black doesn’t mean that China never had a tradition of slavery.
I love the fenqing who have suddenly become so interested in American slavery…I’m sure the African-American community appreciates your “leeching” of their story of struggle in order to prove that Chinese aren’t racist…
Point being, you’re an ignorant asshole.
Reply
-4VeerLeft says:
Wednesday, September 2, 2009 at 11:08 pm
You really have no clue how many married women are fucking someone else do you? LOADS!!! And the only difference is that this woman was getting some black rod… she was likely occasionally doing her husband (as Chinese couples tend to do I’m told) and she decided to have the kid.
Kudos to her…. how would she know what color the childs skin is.
She won the lottery. That child is gorgeous.
Reply
-1blametheparents says:
Thursday, September 3, 2009 at 12:42 pm
“Racist? The chinese didn’t import blacks to the new world like herd animals.”
No, but they did import them to China. In large numbers
http://www.sino-platonic.org/abstracts/spp122_chinese_africans.html
as for genocide, take a look at Tibet. 17% of all Tibetans killed in the last 48 years. That’s pretty impressive killin right on your own border.
But, hey you can prove anything with the facts.
Which the delightfully racist elements in China are happy to ignore. At least in the west we acknowledge racism as wrong, not hold it up as some sort of virtue.
Reply
-4Fike2308 says:
Thursday, September 3, 2009 at 12:59 pm
Yeah, not to mention that blacks in America are probably better off than blacks in Africa.
Reply
+2BroDrknessSZ says:
Saturday, September 5, 2009 at 2:02 pm
Africa is in the state that it is in now because of slavery. If slavery had never happened, the continent of Africa would be more developed and many of the countries would be some of the richest in the world. But then again, many people don’t know this because they can’t think for themselves and instead accept whatever they are taught in school. Africa WAS the richest continent in the world til many of the kings and rulers were taken and families were separated. Since then, all of those countries have been playing “catch up”
Reply
+2Gaad! says:
Sunday, September 6, 2009 at 6:49 am
Yeah! Other people made us this way!
-2Fike2308 says:
Sunday, September 6, 2009 at 11:29 am
“Africa is in the state that it is in now because of slavery.”
Evidence?
Can you site some sources?
rayfish says:
Sunday, September 6, 2009 at 6:44 pm
makes u wonder y as “The number 1 power” they allowed their poor little hynies to be seprated , enslaved etc, doesnt it? o wait did some1 say low IQ?
+1Bam Bam says:
Monday, September 28, 2009 at 6:39 pm
Dear Fike2308,
Africans in Africa are not necessary better off or worse off than their American cousins. All races have good & bad points ditto all the racist comments about Lou Jing.
Unfortunately C’est La Vie.
Regards.
Bam Bam
PS I am an African Black
Reply
-1whatever says:
Wednesday, September 2, 2009 at 6:04 am
I wouldn’t be too self guilty about having certain stereotypes. Specifically on blacks, where do we get the stereotypes from? Hollywood and the western media, the same ones who now propagate the black love fad and evil chinese/asian stereotype.
And these “enlightened” above commenters spew the same, if not worse, hate, racism and stereotypes based on a few internet comments.
Something about a kettle name calling the teapot comes to mind.
Reply
+4ChinaGeeks says:
Wednesday, September 2, 2009 at 7:19 am
Who taped you in front of a television and forced you to watch Hollywood movies anyway? Many of us who grew up in the US managed to grow up much less racist than these commenters, despite the fact that we’re WAY, WAY more exposed to the so-called “Western media” and Hollywood.
As for it being hypocritical for Westerners to say anything….this is PEOPLE talking to PEOPLE. I am not “The West”. I never enslaved a black person. You are not “China”. You never bound anyone’s feet (I assume). Whether or not it’s hypocritical for me (or some other commenter) to say these netizens are racist, well, you have no idea. You don’t know any of us personally. Of course, there are frequently racist comments against Chinese people made on this site so I assume some of the commenters here ARE being obviously hypocritical. But you see my point, perhaps.
In conclusion, lame excuses.
Reply
-2Teacher in China says:
Wednesday, September 2, 2009 at 8:31 am
Well said ChinaGeeks, 100% agree.
Reply
-1elaine says:
Wednesday, September 2, 2009 at 9:35 pm
Also, it’s pot calling the kettle. Not kettle calling the teapot.
Teapots are known to be all sorts of colors. Much like our world.
Reply
-8Fike2308 says:
Sunday, September 6, 2009 at 11:32 am
“Specifically on blacks, where do we get the stereotypes from? ”
My response would be that most stereotypes are based on reality.
Look at Apu in The Simpsons (one of my favorite characters).
It’s funny because where I’m from (L.A.) pretty much every 7-11 is run by people from India!
Also, the stereotype that whites can’t dance and asians can’t drive are based on reality.
Reply
+18Vincent says:
Wednesday, September 2, 2009 at 6:15 am
How does this TV show work? Is it like American Idol, where people vote up their favorites? Because if that’s the case, it looks like she’s ranked 7th, with 1.3 million positive votes and 103 thousand negative votes.
So if this is one of those voting shows, you know, to their credit a lot of people are voting her in spite of her color. That should be mentioned.
Reply
+5Gaad! says:
Wednesday, September 2, 2009 at 6:38 am
Whaaat?! 1.3 millions positive votes and 103 THOUSANDS NEGATIVE VOTES?! There should be absolutely no negative votes whatsoever, dammit! Dang, bugger me silly and rip me a new one, us chinkies are like sooo totally racist, nooo? What does a sista have to do here to catch a break.
Reply
+3whichone says:
Wednesday, September 2, 2009 at 8:22 am
I think a lot of people are voting for her just because she is pretty, if you listen to her sing, she is not all that great actually.
Reply
whichone says:
Wednesday, September 2, 2009 at 8:23 am
http://ent.joy.cn/video/711709.htm
Loujing sings at the competition.
Reply
-5Slappy says:
Wednesday, September 2, 2009 at 7:17 am
Chinese are the most racist bunch living on this planet, only care white skin, white babies, they’re no different than blacks themselves, bunch of farmers the Chinese are!!!
Reply
+7Gaad! says:
Wednesday, September 2, 2009 at 7:26 am
Dude, isn’t the sun a bit too bright for you? Surely, you must miss your hole under that rock of yours very much.
Reply
-2Gaaad!'s GAY lover (Fike2308) says:
Thursday, September 10, 2009 at 9:11 pm
I miss the loose hole between your ass-cheeks gaad!
Now stop flaming these laowai and come flame my yellow balls!
Reply
+3水溶C100 says:
Wednesday, September 2, 2009 at 7:47 am
I don’t think anyone should worry about this, a great deal of mainland Chinese people just aren’t used to this kind of multiculturism. Most of these comments probably come from people who have never even talked to a black person before.
Reply
-14PUSAN PLAYA says:
Wednesday, September 2, 2009 at 8:13 am
I’d do her but I’d keep one eye on my wallet.
Reply
+13Gaad! says:
Wednesday, September 2, 2009 at 8:35 am
I could do YOU but I’ll keep BOTH my eyes closed with tiger balm on my upper lip. Better yet, give you a paper bag to cover your skanky Pusan face.
Reply
-7PUSAN PLAYA says:
Wednesday, September 2, 2009 at 6:32 pm
Gaad!: I’m flattered but the only man I’d ever go homo for is famous Korean singer Rain.
Reply
+10Gaad! says:
Wednesday, September 2, 2009 at 9:32 pm
Giggles! You think I’m a guy? Man, I need to get your Pusan puss acquainted with me jinky-kinky collection of strap ons. Betcha u won’t feel the same about da ladies after that, or much of anything else for that matter.
Reply
+8Mike Fish says:
Wednesday, September 2, 2009 at 9:07 am
All those guys, and they are certainly mostly guys, making those comments will be lucky to ever be with a girl as attractive as she is.
Reply
+8Chinalbeit says:
Wednesday, September 2, 2009 at 10:10 am
Fixed your post:
All those guys, and they are certainly mostly guys, making those comments will be lucky to ever be with a girl
Reply
+1Mike Fish says:
Wednesday, September 2, 2009 at 8:23 pm
True… you fixed it well.
Reply
-1malagebi says:
Wednesday, September 2, 2009 at 9:47 am
Chinese are just angry their little dicks couldn’t keep a woman from going off and cheating with a black guy.
Reply
+8Gaaad! says:
Wednesday, September 2, 2009 at 10:59 am
Wow! Somebody seems very familiar with Chinese men’s genitalia.
Reply
+6A says:
Wednesday, September 2, 2009 at 11:49 am
Wow, answering racism with racism. that’s really likely to work. good job. You must be really proud of your penis. Why else would you poke fun at others?
Reply
+12Fred says:
Wednesday, September 2, 2009 at 10:23 am
@Gaaad!
China’s first Foreign Minister, Eugene Chen, was a mixed Chinese and black (from Trinidad).
He was Sun Yat-sen personal adviser and private secretary, a position he held until Sun Yat-sen’s death in 1925.
http://politicalbiographies.suite101.com/article.cfm/return_to_the_middle_kingdom
Time Magazine, in its Dec. 11, 1933 issue, noted “the new Fukien Government has as its ‘brains’ that amazing man of South Chinese politics, Eugene Chen.”
http://www.time.com/time/magazine/article/0,9171,746478-3,00.html
Eugene Chen’s grave stone in Ba Bao Shan
(Mountain of Eight Treasures) Revolutionary Martyr Cemetery in Beijing.
http://yuantsungchen.com/new_page_6.htm
Whites are very quick to label Chinese racists when it comes to blacks yet China is far down the ladder as being an anti-black “racist” country. I believe that honor belongs to Poland, Russia, and the Ukraine.
Yes, there are Chinese who have anti-black sentiments. So what? In Africa, there are blacks with anti-Chinese sentiments. No need to discuss the anti-every(race) views in the “civilized” countries – the US, the UK, Europe, etc. Matter of fact, xenophobia is the coin of the realm.
Unless there is a higher quality of humans in the world, racism (xenophobia) will continue to exist. Until then, people just have to suck it in and fight back!
Reply
+4Gaaad! says:
Wednesday, September 2, 2009 at 11:17 am
Thx for the links, much appreciated. A fascinating and mesmerising history.
Reply
Anon says:
Wednesday, September 2, 2009 at 10:37 am
Excusing your racism by citing others as racist is amazing but sadly expected from such dimwits.
As always they want it both ways. The victim chip on the shoulder complex with the west but the superior complex with others.
Is there even a racial dscrimination law in China? If there is you know it will be toothless.
!
Reply
Gaaad! says:
Wednesday, September 2, 2009 at 11:10 am
Nope, no racial discrimination law in China (HK excepted) that I can think of. Everybody is expected to stand up for themselves so that they can stand on their own and be proud of that fact (apart from some affirmative action privileges and financial aid for “recognised” economically under-developed minorities that is). Everybody is expected to be tough as nails and if you fail, too bad, that’s the market economy for you.
Reply
-2Josh says:
Wednesday, September 2, 2009 at 2:18 pm
Don’t try to talk about “standing up yourself” and being “tough as nails” because that’s horseshit and you know it, I know it, and so does everyone else here. I’d like to see you stand up to a mob who are filled with loathing for you because of your skin color. And market economy? I wonder what the Uighurs in Xinjiang would say to that when they see job advertisements that say “只要汉族人。”
Reply
+4Gaad! says:
Wednesday, September 2, 2009 at 9:42 pm
Eh…sombody obviously missed hitting the sarcasm tree when he was just a wee apple falling off his daddy’s tree, non? Here, have some more cha. You’re choking on all ya righteous indignation and going green in da face.
Besides, are you going to let a sign put you off?
Reply
-1Josh says:
Thursday, September 3, 2009 at 9:27 am
What can I say? Trends in comments tend to lead the reader astray. Besides, given the apparent surplus of bulldozing fenqing, it’s easy to see where mistakes may be made.
+3Gaad! says:
Thursday, September 3, 2009 at 11:15 pm
Well, ain’t some hommie a quick draw with da lable and name calling when it comes to disagreeable comments. Git personal is da name of da game, non?
“Da healthcare reform iz EVIL! EVIL it iz I tell y’all!”
I find that people who are full of righteous indignootions usually have a corky up an orifice somewhere, whether physically or mentally.
+5Rick in China says:
Wednesday, September 2, 2009 at 11:23 am
She’s gorgeous.
Reply
-2jmoney says:
Wednesday, September 2, 2009 at 11:41 am
Hot Chinese girl with junk in the trunk.
Reply
-1A says:
Wednesday, September 2, 2009 at 11:52 am
ooh right.. cuz chinese girls are flat and black girls are really curvy right?? how clever
Reply
+1VeerLeft says:
Wednesday, September 2, 2009 at 11:12 pm
There is no truth to that? or are you just blind…
I am not making judgements either way on appearance but…
BTW…
1) there are tons of black ‘races’…
2) Chinese is a NATIONALITY… not a race
Reply
-4Fike2308 says:
Thursday, September 3, 2009 at 6:31 am
Yes, Chinese girls are usually flat and not as curvy as black women….or western women.
Tits and asses are not appreciated in the middle kingdom.
Reply
+4Gaad! says:
Monday, September 7, 2009 at 12:50 am
Reminds me of ya motha…
Reply
+4Michelle says:
Wednesday, September 2, 2009 at 11:42 am
What is wrong with everyone? I think she is a beautiful mix and she must have such an interesting heritage.
Her parents are just normal people. How can you judge them without knowing anything about them? Maybe the mother’s husband was a complete arsehole.
Reply
+19Jon says:
Wednesday, September 2, 2009 at 11:48 am
What a topic, huh?
China is racist, like all countries. The fact that the population is overwhelmingly of one race (90% Han last time I checked) doesn’t help this fact. One big problem I have with Chinese racism is that it is considered completely acceptable by most of society. No one is going to speak up when someone makes a racist comment. For example I celebrated Spring Festival with my old host family and the dad made a joke that Obama will turn his milk black (or something like that), the family was so surprised that I, a white Anmerican, would consider that wrong. Or consider the story of a black English friend of mine who taught at a public school in Hunan. One of her students drew a picture of her as a monkey playing basketball. Naturally upset she went to the administration. What did they do? The principal laughed at the picture and refused to punish the student. While all of this is going on the government makes out China to be a place that loves people of all colors. That’s not what they’re saying on the streets.
I think a lot of Chinese consider the West (whatever that is) as racist as them, no doubt due to our horribly racist hsitory. But the fact is we take racist actions very seriously and I’m fairly certain China would too if the country wasn’t so damn homogeneous.
Reply
-1kris says:
Wednesday, September 2, 2009 at 1:52 pm
couldn’t agree more, what’s lacking is any form of intelligent dialogue about race, if this forum is an example there is a long way to go. i think there is more to it than just being homogeneous, education, and worldliness are still stumbling blocks for China.
Reply
-5whichone says:
Wednesday, September 2, 2009 at 5:25 pm
lol the story with the little kid is fucked up but also kind of funny…
Reply
VeerLeft says:
Wednesday, September 2, 2009 at 11:13 pm
Homogeneous=Inbred
Reply
-2Fike2308 says:
Sunday, September 6, 2009 at 10:39 am
I agree with VeerLeft’s equation.
Reply
+2Gaad! says:
Sunday, September 6, 2009 at 10:54 am
Yeeeee!!! What a cute lovely couple you too make!
Reply
-4Fike2308 says:
Sunday, September 6, 2009 at 1:42 pm
Why are you following me around?
It seems like every time I make a post you have to hurl some random insult at me.
Very weird.
+2Gaad! says:
Sunday, September 6, 2009 at 10:19 pm
Cause you soooo angry dat you a soooo cutie! Me likesy precious!!!
-1Anon says:
Thursday, September 3, 2009 at 7:56 am
The sad thing is that it is not seen to be morally wrong at all.
Next time they bleat about anti Chinese(government) bias this should be thrown back in their faces.
It reminds me of nothing more than bullies who can act big but whine like children when it comes back their way.
Reply
+1Eric says:
Friday, September 4, 2009 at 1:46 am
USA takes asian racist actions seriously?
I forgot you are white and you seem to know whats going on even though you are not asian
Reply
-1capt. NULLZ whatever says:
Wednesday, September 2, 2009 at 12:15 pm
Well, that there destroyed my naieve notion that China is merely backwards due to being a more homogenous culture. I don’t think there is any excuse for this!
BTW, I’m in LOVE! Marry me???
Reply
+8Noele says:
Wednesday, September 2, 2009 at 12:31 pm
Very beautiful girl. What a shame that she has to bear the brunt of such vitriol from ignorant morons.
Seriously, I was very surprised at how degrading some of the comments were. Even if her mother chose to have sex with a black man, why should they give a damn? Her mother is an adult, she made her choice and she has accepted responsibility for her actions. Who you fuck/date/marry is no one else’s business.
Reply
+11Rick in China says:
Wednesday, September 2, 2009 at 12:56 pm
While I agree with all of your points – the moment you thrust yourself into the spotlight (ie. appear on national TV, or media, or whatever) you need to be ready for any and all criticisms that may come your way.
While it’s none of anyone’s business, she chose to make it everyone’s business. You can’t have fame and privacy, publicity and no criticism. They go hand-in-hand, and to think otherwise is ignorant.
That being said, I hope this blows over and, maybe…who knows…opens up some people’s eyes to the issues around racism in China, maybe for the better. Sometimes it takes people who bridge gaps by being multiracial even though they’re seen as a single race, to help build these bridges. (Asian Obamette maybe? haha..)
Reply
+1Noele says:
Wednesday, September 2, 2009 at 1:01 pm
You are definitely right, the whole thing just feels unfair though…eh, I guess life’s not fair sometimes. :-D
Reply
+4Josh says:
Wednesday, September 2, 2009 at 2:27 pm
While you make a point, Rick, there’s a big difference between the lack of privacy that accompanies being a public figure and a slew of racially driven criticisms.
Case in point, it’s one thing to make fun of Obama because he has big, funny ears that stick out. It’s quite another to scream “ni–” and “kill him!” at a Sarah Palin rally. Both are inexcusable and should be addressed immediately rather than throwing up your hands and saying, “well, that’s life!”
Reply
Rick in China says:
Wednesday, September 2, 2009 at 4:57 pm
Are you serious? Know your audience. Everyone seems pretty much in agreement that racism is rampant in China. There should be absolutely no surprise that people are posting racist comments on forums and such as a result of her coming out. Again, *it would be ignorant had they not expected it*.
I never excused it. I simply said it would be ignorant for them to have not expected this backlash. In fact, I think it will end up being very good for her – career wise. If nobody said shit, she’d just be another one of a million.
Reply
the great yellow master race says:
Wednesday, September 2, 2009 at 2:15 pm
right. i hope she is not like britney spears..
Reply
dace says:
Wednesday, September 2, 2009 at 12:42 pm
I saw that show, and the TV presenter had the girl in tears, cos she kept asking about her absent father, where he was from and why he ran away. Just by coincidence (not), there was another Chinese-African kid on a the same show a few days later, and again they were playing up his blackness (he was doing Michael Jackson imitations). This kid’s African father was not openly refered to, but I was waiting for the presenters to start milking his story for all it was worth too.
Reply
-9ChinaJim says:
Wednesday, September 2, 2009 at 1:01 pm
I agree with the Chinese commenters on some areas here. This was similar to the outrage whites had when they saw a mixed black/white couple in the 1950’s in the U.S. Gradually they relaxed there standards now you have tens of thousands of bastards born to white women eveyr year when their black boyfriend runs away. Often the grandparents end of raising them but this social experiment never works. They still end up dropping out of school or end up in prison. 90% of black Children are born without a father married to the mother. Not to mention the violence in their community.This is in the gene code, look at Hati, any country in Africa, parts of major American cities, etc… you only find destruction, violence, and poverty.
Reply
Rick in China says:
Wednesday, September 2, 2009 at 1:07 pm
It’s amusing how many people from Mississippi and China share the same views, yet are raised a world away. I don’t know which of these you are more likely to be – neither have a reputation for grammar/spelling or tolerance.
Have you been to Ha(i)ti? Any parts of Africa? In fact, people I’ve met in Tanzania happen to be amongst the least violent or aggressive I’ve met, anywhere.
Reply
-2ChinaJim says:
Thursday, September 3, 2009 at 9:36 am
Rick the Prick- How did you know I was from Mississippi?Interesting how you don’t mind sterotyping Southern whites or Chinese but god forbid someone speak the truth about your precious black people. Hope you can stop teaching English for a second to read this post you loser. Go find a real job. You all show your lack of education and itellectual horsepower with your reply. I talk about statistics…you all start with …well I know this guy or such and such. You clearly are brain dead and don’t understand anything about population distribution. On average, Chinese are are shorter than westerners…no there not, Yao Ming is 7″6. You do have one point, East African’s are less violent than West Africans. By the way, can you find one city in the world with a black majority that is not a violent , desperate, hell hole? Didn’t think so. Ever check the FBI crime stats in the U.S.? Ever think for yourself? Go back to your fantasy now…class will be starting..
Reply
+1Fike2308 says:
Thursday, September 3, 2009 at 11:31 am
“On average, Chinese are are shorter than westerners…no there not, Yao Ming is 7″6.” – ChinaJim
Um, do you know what the word AVERAGE means?!?!
Yao Ming is NOT your average Chinese person!
Based on my experiences in China, Western people, on average, are taller than Chinese people.
Yao Ming is an exception to the rule, not the rule itself.
Reply
+3Fike2308 says:
Thursday, September 3, 2009 at 11:33 am
I hate mindless insults like:
Go find a real job.
Get a life!
Your momma!
Etc.
Reply
Gaad! says:
Sunday, September 6, 2009 at 11:29 am
U seem very good at it.
-1Fike2308 says:
Sunday, September 6, 2009 at 1:44 pm
Can you show me where I have used any of those insults?
Also, why are you stalking me? It’s like you’re obsessed with me.
+2Rick in China says:
Thursday, September 3, 2009 at 1:27 pm
GAaaaahahahahaha.
1. I’m not a teacher. In fact, there’s a very small likelihood you are nearly as successful as I am, speaking on averages.
2. I didn’t say all people from Mississippi or China behave like that, but “many” in terms of how they are perceived, do, hence the ‘joke’. I’ve not been to Mississippi, nor do I know anyone from there, so I can’t seriously claim to know shit about them.
3. You claim I am the one who is “lacking education”, lets see:
a. “itellectual horsepower” (int)
b. “no there not, Yao Ming is 7″6″ (they’re) + (7′6″)
c. “East African’s are less violent than West Africans” (Africans), + You don’t know shit about Africa, moron, Somalia & Sudan? It’s not separated east/west=violent/nonviolent. Stop talking about shit you know absolutely nothing about.
d. “Can you find one city in the world with a black majority that is not a violent, desperate, hell hole?” Accra. Wait, you wont know where that is; it’s in Ghana. Look it up. Wait.. Ghana, Ghana is a country in West Africa which borders the ivory coast (go figure).
Reply
-1ChinaJim says:
Thursday, September 3, 2009 at 3:39 pm
Rick the Prick-
Thanks for correcting my grammer Mr. Succesful. Let me guess, your CEO of an trading company? haha
Let me know when you actually sell something.
I drive a BWM 7. Now go get your scooter.
By focusing on typo’s you deflect the real arguments.
By saying W.Africans are more violent than E.Africans does not mean E.African’s are not volent. My God dude, you have no critical thinking skills at all.
I reccomend you study some basic Greek Logic.
Face it dude, you live in a fantasy world. Did you notice I argue against your statements, where as because I do not share your viewpoint I am somehow “un-educated”.
Your the programmed one, not me. Go back to your Matrix Pod.
Regarding Ghana, Ya, great place. Ghana has a high HIV infection rate,extreme violence to women and most of the population lives on a dollar a day.
-1Rick in China says:
Friday, September 4, 2009 at 2:53 am
You called me uneducated, Jim. Then you went on to rant…a rant riddled with many language mistakes – that’s the irony, Jim, which you exhibit very clearly for all to see.
I’m not even going to address the rest of your ridiculousness, it’s not worth my time.
+2funny-orient says:
Monday, October 5, 2009 at 10:00 pm
ChinaJim is an a#$h%le.
1.Ghana has the about the lowest HIVr rate in Africa.
2. No woman is discriminated against here (except Jim’s mother who came here and was running a brothel serviced by Chinese girls after seizing their passports.
3. West Arica has only the black sheeps of Liberia (now calm) and Sierra Leone (serene).
Jim get a tutor and I hope u regret cheating in your history lessons in grade school. You know?, dont make a comment about something you dont kow shit about. it only makes you look STUPID. If u had kept your mouth close, we’l have thought you wise.
Medentze says:
Saturday, September 5, 2009 at 12:07 pm
Mmmm, I love the taste of ignorance in the morning. I like it bitter just like my coffee!
ACTUALLY, there are many prosperous African nations, let alone cities. Please educate yourself before commenting on the state of a continent which you know ABSOLUTELY NOTHING ABOUT?
Right then. Feel free to return to your poorly-informed worldview now.
Reply
A says:
Wednesday, September 2, 2009 at 5:40 pm
Aaah. The master geneticist as spoken. He’s found the gene for parental absenteism that only manifests itself in black males throughout the world. The may be spread throughout the world but their genes are all the same. what a revelation from a truly enlightned mind. I especially like that statistic. I’ve met countless young black indivduals in my lifetime and the only one who did not have a father had lsot him to the warfront. I guess I was really lucky to always fall in the 90% right? I’m really interested to know where you got that statistic Chinajim. Did you also come up with a name for that gene you discovered?
Reply
-2ChinaJim says:
Thursday, September 3, 2009 at 10:13 am
Here you go A.
I stand corrected…It’s not 90%…it’s only 70% of black children born out of wedlock.
http://www.npr.org/templates/story/story.php?storyId=4865449
The DNA gene code you asked about is as follows: ATCGCGATGTTACGCHIMPATTCGCGAGACGACCGATTAT
Reply
Rick in China says:
Thursday, September 3, 2009 at 1:30 pm
Very witty to throw a “chimp” in your pseudo-code.
You’re not worth the time to argue with. Just another ridiculous bigot.
Reply
-2ChinaJim says:
Thursday, September 3, 2009 at 3:56 pm
haha- opps, that was a typo. Here is one you won’t figure out.
I meant to type…..ACTGGGCATTAGAATTCGATOMOHASIKCIRAATTCCGGATCG
Rick in China says:
Friday, September 4, 2009 at 2:54 am
Genius.
You’re also anti-gay, then, ya?
Jmencalisse says:
Wednesday, September 16, 2009 at 3:09 am
Out-of-wedlock births are also rising in much of the industrialized world: in Iceland, 66 percent of children are born to unmarried mothers; in Sweden, the share is 55 percent.
http://www.nytimes.com/2009/05/13/health/13mothers.html
Reply
+2VeerLeft says:
Wednesday, September 2, 2009 at 11:20 pm
Let’s pretend that you are NOT an idiot….(for the sake of argument)
By your logic the genetically submissive yet devious mother cheated on her genetically inferior and under-endowed husband… with the genetically masculine and genetically irresponsible black american…
How should this reflect on the Genetically diverse and physically pleasing child?
Oh wait…. the commenters are GENETICALLY STUPID AND GENETICALLY incapable of empathy. Well thats inbreeding for ya…GENETICALLY speaking.
Reply
Mi wewe says:
Wednesday, September 9, 2009 at 5:02 pm
ChinaJim welcome in Tanzania, stop talking bullshit you not sure of ”HAKUNA MATATA”
Reply
+1Jmencalisse says:
Wednesday, September 16, 2009 at 2:50 am
Yeeeeh!And everyone knows that China is a marvelous lands with lots of happy beautiful people, national health insurance and pink poneys.
You know Africa so well and I guess you can tell violence is in gene code because you got Ph.D. in Molecular Biology
Reply
Rocknrollstar says:
Wednesday, September 2, 2009 at 1:13 pm
Wow, I guess most of these farmers have never left the country and don’t know anything besides their own culture.
Ironically cheating seems to be part of this culture – or which Chinese man goes to KTV only for singing? What about all the pink lighted massage parlors? Only for singles? What about the second wife phenomenon?
This debate shows once again the double standards in China.
Reply
Yin says:
Wednesday, September 2, 2009 at 1:18 pm
I don’t think this is a case of double standard. Ask these netizens how they feel about officials with second wives and they’ll give you the same response. Where the double standard might exist is what they do with their own lives as they get older. Young people are often self-righteous. But as they become adults and enter into that corrupt, cynical, dog-eat-dog world, their views begin to change.
Reply
Rick in China says:
Wednesday, September 2, 2009 at 1:32 pm
It’s called hypocrisy – and it’s not limited to China. Look at all the republicans in the US being busted right now for preaching about family values, yet caught with their mistresses? How about the priest who faked his own kidnapping so he could spend more time with his mistress? This is definitely not a China-only circumstance, it’s a human circumstance that happens everywhere from developed, developing, and undeveloped nations – I’m sure the Korowai cheat sometimes too, the difference is the result is the cheating husband/wife ends up as his/her family’s next meal.
Reply
The John says:
Wednesday, September 2, 2009 at 1:51 pm
I agree. However…
I think they will NOT give the same response. It will be, “Oh, those officials suck, because they had second wives.” It will not be an attack on their children s or wife’s race.
The problem is not with what people say, but what people do. People say one thing and do another. It is hypocritical and annoying. So many pink houses and a lot cheating exists in China… A place where prostitution is illegal.
Also, I don’t agree with the older example you gave. Having experience in education, I can say a LOT of middle school students in China are sexually active. The parents are clueless. Bad behavior starts young and matures as people get older. Same thing happens to good behavior. No one just grows up and do indecent things because society is that way. They learn these things from an early age and it just matures. That doesn’t mean society can’t influence them. But, at their core people’s identities are composed of nature and nurture.
The self righteous problem doesn’t only affect the young. I noticed that many “adults” are also self righteous as well. Just not many people can back up the righteousness. So we live in a society where these same self righteous adults, create young self righteous children. The circle restarts over and over. But, no body just comes out and faces things directly.
As for this case of cheating, I don’t know if I can say her mother was right or wrong. I simply don’t have enough details AND I don’t care, because it’s none of my business.
Reply
Yin says:
Wednesday, September 2, 2009 at 1:58 pm
So what’s your solution?
Reply
+1shenyang says:
Wednesday, September 2, 2009 at 6:12 pm
Solution: Be the best person you can be, and try your best to obey the rules of your society, or choose to leave your society if its rules don’t agree with yours.
+2The John says:
Wednesday, September 2, 2009 at 1:19 pm
Hello!
Well, I just want to say. She is hot and I would probably tap it. Ok, Definetly…
I think there are a few issues that I haven’t seen addressed. 1. WHY IS IT ANYONE’S F*CKIN BUSINESS WHAT HER MOTHER DID? Anytime a chinese person goes on these shows, they don’t do a back ground check! Now, because she’s black, they MUST make sure her history is justifiable for the Chinese audience. Are we in America? (The oh, lets check the black guy and make sure he is not a gangster mentality, is not wide spread in the U.S., but it happens. F*CK!) At least, in the states someone can sue for this kind of sh!t!!!!!!!
Also, how can people pretend the know the whole story of the affair. Maybe, her husband was a lying sack of crap and she felt lonely. Maybe, the guy she had an affair with didn’t know she was pregnant. It’s all so upsetting to see another case of Chinese unable to mind their own business. But, the big question is…. What does this have to do with this innocent girl? She was not involved in her mother’s affair and at least I respect her mother for taking care of her.
The next problem, I noticed in China is the point the finger philosophy. It happens way too much here. Its not everyone, but its enough to piss me the hell off!!! In China, how many people cheat? All of my friends have been cheated on. Men and Women. To be honest, not all of them were angels. They cheated too. But, when someone that is black, goes on tv…. It’s like, lets hate the monkeys. Truly upsetting…
Don’t look outward, without looking inward.
Yes, I know that there are many Chinese that are not racist. However, I will say that A LOT of mainland Chinese dislike OR are completely ignorant about black people. I know a lot of people that refuse to hire black people. Shenzhen and Guangzhou has some issues like this. Some of them, don’t even check there qualifications. The funny thing is I am good friends with a lot a black people and they get along with Chinese well.
Some Chinese also use the examples of Nigerians near the coastal cities, committing crimes as an excuse to justify their racism. I know for sure that every foreigner cannot do business without a Chinese helping them in some way. So, if someone in China is getting away with illegal activities, im sure they have some guanxi with local Chinese. Especially, when the penalties for drug trafficking is so high. So, you can’t blame all black people for the co-operation of some foreign idiots with local idiots.
Im not surprised to hear about this. I think as China develops even more. A lot of truth will come out. Especially, matters regarding race…
Reply
-1THE KID says:
Wednesday, September 2, 2009 at 1:34 pm
IM VERY GLAD CHINESE PEOPLE ARE TARGETS OF RACISM AND PERSONAL ATTACKS WORLD WIDE….
THE chinese people who travel only hangout with chinese people unlike Japanese korean etc.
The Chinese people who are stuck in China for good, ARE JUST CONFUSED ON LIFE.
PS. That girls body looks HOT
Reply
+4A says:
Wednesday, September 2, 2009 at 5:49 pm
Ah yes. it’s really fair to wish to perpetuate racism on the whole of China because some people in China are racist. that will really help clear the world of all racism.
Reply
-1Jimmy says:
Wednesday, September 2, 2009 at 6:28 pm
Are you serious? At my university, that’s common with the Chinese, Japanese and Koreans. They hang out with each other all day and speak their native language, but stutter making basic English conversation, but that’s another topic.
Reply
+2KTR says:
Wednesday, September 2, 2009 at 2:14 pm
She’s a beautiful girl, her skin colour shouldn’t matter. You Chinese are just petty minded racists, would it be such a problem if her father wasn’t black?
Reply
+2shenyang says:
Wednesday, September 2, 2009 at 2:17 pm
I’ve learned to accept Chinese racism for what it is. In 3 years in Shenyang I’ve heard many appalling comments from Chinese people about other races, but there was almost one underlying similarity: None of them said the comments with hate.
In my experience, those people did not hate, and hate is what makes racism bad. Discrimination isn’t always bad, and is a necessary part of living. There is no way to deny that people are different. Chinese who make racist comments are simply regurgitating opinions that have been formed by living in a single-race society. They have little hate in their hearts for these other races most of the time. The other times, their stereotypes have been reinforced by one or two personal experiences that had been negative and were never offset by positive experiences.
For example, if someone tells you that red=1 and green=2, and all your life you had never seen red nor green, then finally one day you see one instance where red=1, you will be inclined to believe that first of all it is true, and second of all you will make the jump to the conclusion that green must equal 2 as well.
Chinese people that I know that have been exposed to many more personal experiences regarding different races are not racist and do not make such comments. These comments are born from inexperience.
Reply
The John says:
Wednesday, September 2, 2009 at 5:26 pm
From the dictionary:
racism /ˈreɪsɪzəm/ Show Spelled Pronunciation [rey-siz-uhm]
–noun 1. a belief or doctrine that inherent differences among the various human races determine cultural or individual achievement, usually involving the idea that one’s own race is superior and has the right to rule others.
2. a policy, system of government, etc., based upon or fostering such a doctrine; discrimination.
3. hatred or intolerance of another race or other races.
http://dictionary.reference.com/browse/racism
Racism fosters hatred. In some ways it is a form of hatred, because it implys inferiority. Hatred can also be ignorant. When someone realizes the stupidity of their hatred, they will change. Usually, because they realize how ignorant they were.
I have done somethings im not proud of. But, I cannot make an excuse for them. I have even hated. Illogically and ignorantly. I wasn’t even aware I was hating. So, im glad I took the time to educate myself. Others should too.
Reply
+1shenyang says:
Wednesday, September 2, 2009 at 5:41 pm
I totally agree with you. Acceptance of other customs, races, religions, cultures, etc., comes from a willingness to learn the beliefs of each. Those who cannot accept how others are different from them are destined to be isolated from the rest of humanity for the near future at the very least. Humanity’s strength lies in its resilience and adaptability, and racism directly attacks that strength by assuming that one part of humanity is better than another. This, according to Charles Darwin, is true. It was not, however, based on race, but on adaptability. Those who can adapt, will survive. Those who cannot, will die.
Reply
-1Mike Fish says:
Saturday, September 5, 2009 at 9:21 am
Are you suggesting China should adapt to the world or LouJing should adapt to the racism?
Reply
capt. nullz whatever says:
Wednesday, September 2, 2009 at 2:28 pm
why is whatever guy taking over my name???
Reply
-4Biggus Dickus says:
Wednesday, September 2, 2009 at 2:58 pm
I’d fuck her. Well horny. Bet she has nice perky dark nips.
Reply
-7BlackDonginHongKong says:
Wednesday, September 2, 2009 at 3:03 pm
Laugh at all the stupid racist Chinese blogging like crazy and all actually acting themselves like a bunch of monkey niggers. Fuck off you racist pigs. Chinese people are more like monkeys than black people are. Ooophhhh Ooophhh Ooppphhh just keep spitting on the street you gob-shite slit eyed chinky monkey niggers. The world was better off when China was closed. Now fuck off back into Communism you nasty fucks. You’ve got to be dumb and stupid to allow the Commies to rule you. Black cocks rule weeny yellow tiny Chinky penis anyday.
Reply
-1whichone says:
Wednesday, September 2, 2009 at 5:37 pm
Well said, if only those racist Chinese pigs (or is it monkeys?) are as open minded as you, the world would be better off.
Congratulations on your black cock, fantastic job, here is your prize:
//\
V \
\ \_
\,’.`-.
|\ `. `.
( \ `. `-. _,.-:\
\ \ `. `-._ __..–’ ,-’;/
\ `. `-. `-..___..—’ _.–’ ,’/
`. `. `-._ __..–’ ,’ /
`. `-_ “–..” _.-’ ,’
`-_ `-.___ __,–’ ,’
`-.__ `—-”"” __.-’
`–..____..–’
Reply
-1ton says:
Wednesday, September 2, 2009 at 5:41 pm
.//\
.V \
. \ \_
. \,’.`-.
. |\ `. `.
. ( \ `. `-. _,.-:\
. \ \ `. `-._ __..–’ ,-’;/
. \ `. `-. `-..___..—’ _.–’ ,’/
. `. `. `-._ __..–’ ,’ /
. `. `-_ “–..” _.-’ ,’
. `-_ `-.___ __,–’ ,’
. `-.__ `—-”"” __.-’
. `–..____..–’
Reply
-6Haha says:
Tuesday, September 22, 2009 at 12:47 pm
Nigger cocks with tumors, AIDS deformities, 2 pounds of shit, genital warts and crawling with crabs.. rules the eight circle of hell, maybe.
Niggers are a bunch of filthy, retarded chimps. I hope more niggers die of AIDS.
Reply
+2Grace says:
Wednesday, September 2, 2009 at 3:46 pm
quitting saying bad things about the mother and the daughter. Give a little love to them, shut your mouths,and mind your own business. Okay, don’t be nasty to them. They need help and understanding.
Reply
+2BlackFrench says:
Wednesday, September 2, 2009 at 4:01 pm
First of all, this girl is beautiful and proves once more that mix race gives the best results.
Her mother and herself must have lived difficult moments in such a mono cultural country…
About chinese racist comments…well not a big deal : don’t expect tolerance and smartness from narrow-minded people who have certainly never seen, never talked to a non-chinese.
It’s always the same story : fear + ignorance + cliché = racism
So…Lou Jing, Keep it up…racists either open your eyes/mind or get lost.
Peace
Reply
+8Righteous American says:
Wednesday, September 2, 2009 at 4:09 pm
She’s definitely one of the hottest chinese women I’ve ever seen.
Reply
Nicki says:
Wednesday, September 2, 2009 at 4:49 pm
She’s beautiful. I hope she has the emotional strength to weather this storm.
I read a story once where all the people in the world were approximately the same color of tan because they’d mixed races to the point where there were no discernible races anymore. Wonder how long that would actually take….
Reply
-1Rick in China says:
Wednesday, September 2, 2009 at 4:59 pm
Humanity will always find a way to segregate.
Reply
Fike2308 says:
Thursday, September 3, 2009 at 9:36 am
Seriously….if we were all white people would segregate on height, eye color, etc.
Reply
-1Rick in China says:
Thursday, September 3, 2009 at 1:34 pm
There is a perfect example of that which already happened in Rwanda. That’s why there was a civil war/genocide.
The Belgiums separated a once-single tribe of people into 2 tribes, Hutu and Tootsis, based only on their skin tone (light/darker) and height. We all know the results.
Reply
Rick in China says:
Thursday, September 3, 2009 at 1:36 pm
Belgiums should be Belgians.
Whatever.
-2ChinaJim says:
Sunday, September 6, 2009 at 1:16 am
Holy Shit is Rick Stupid.
This guy is so brainwashed. Here he is again slagging off “Belgums”. Try getting your history from some other source than a movie dipshit.
The million plus dead in Rwanada had nothing to do with whites. You libs treat Blacks like they are children, they can’t possibly kill each other without whitey causing it. The Hutu’s are a Bantu people and the Tutsui’s are a East African people hence they do look very different and have different mental capabilities. These are ethnic subgroups, people are not all the same just because there skin looks black to you. Once again I will tell you…PICK UP A BOOK ONCE IN A WHILE.
Gaad! says:
Sunday, September 6, 2009 at 9:28 am
ChinaJink needs to looky at da role of da Frenchies during da Rwandan Genocide more closey me thinks.
PICK UP A BOOK BOOK ONCE IN A WHILE (me likes shouty too)
-1Fike2308 says:
Sunday, September 6, 2009 at 10:37 am
Isn’t the “go read a book” insult kind of getting old?
-1Gaad! says:
Sunday, September 6, 2009 at 11:32 am
Not for Fike it ain’t.
-1Fike2308 says:
Sunday, September 6, 2009 at 12:31 pm
Actually, I don’t go around insulting random people and using tired cliches like “Go read a book”.
It seems like a naive assumption that just because something is in a book it is uncontestably true.
Compare Chinese and Japanese history textbooks concerning WW2 for instance.
-1Fike2308 says:
Sunday, September 6, 2009 at 1:46 pm
Oh, now I get it.
My “Isn’t the “go read a book” insult kind of getting old?” comment offended Gaad! so now he/she has to look up every post I make and hurl some random insult at me.
Well, I hope you get bored of me soon Gaad and start pestering someone else.
+3Gaad! says:
Sunday, September 6, 2009 at 11:10 pm
No, not that. Saw you other day walking. Your ass very cutesy. Me like riding.
Shanghairocks says:
Wednesday, September 2, 2009 at 5:03 pm
Typically Chinese .. !!
Reply
+1Tim says:
Wednesday, September 2, 2009 at 5:58 pm
I think she is stunningly beautiful!
Reply
+1jedknowsbest says:
Wednesday, September 2, 2009 at 6:12 pm
She is BEAUTIFUL and at the end of the day fully CHINESE!
Reply
-16lol says:
Wednesday, September 2, 2009 at 7:04 pm
you fucking retard.
she is not. her father is what, american?
that makes her half chinese, half american.
shut the fuck up with your fucking nationalist attitude you dumb shit.
Reply
Gaad! says:
Wednesday, September 2, 2009 at 10:14 pm
Well I accept her as fully Chinese as many more do too seems like and is she not also a Chinese citizen?
Besides, Obama is half white and everybody, including his black brothas and sistas, call him the first black US president. Why’s dat?
Reply
Buhaoyise says:
Wednesday, September 2, 2009 at 6:13 pm
My eyes hurt from reading the translated Chinese commentary.
People’s attitudes towards the mother are almost as lamentable. What ‘mistake’ did she make?
Reply
+1RobinBeijing says:
Wednesday, September 2, 2009 at 6:17 pm
Wow, see all kinds of emotions stirred up here, so it’s an eye for an eye then, Western hypocrisy and racism meemt their chinese counterparts.
Basicly, Chinese Fenqings say a lot of stupid things, their comment to Lou JING is only a small part. But they are a minority group of the society, and their name in chinese, Shit Youth, says much.
Most of the Chinese are not hateful on races, they are just ignorant on races, as China is what it is, a country of one race. Interestingly, China was not always a country of one race, it become one because of culture assimilation and inter-racial marriges going on thousands of years.
Reply
+1shenyang says:
Wednesday, September 2, 2009 at 7:32 pm
Race centrism is especially interesting here in Shenyang. Shenyang was never really part of China until the Qing Dynasty, but they still claim the entire history as their own here. I recently asked the question whether or not my wife’s grandfather was in fact born in China, and was met with surprise. He was born in Manchuria, which was not part of China, but people here tend to forget that. The Han people tend to forget that their race has continually assimilated other peoples over the centuries, and that Chinese does not mean Han.
I asked some Chinese youths if I would be Chinese if I had a Chinese hukou and passport, and they said, “Of course not.”
I then asked why. They said that I don’t “Look Chinese.” So I asked whether XinJiang Muslims looked “Chinese”. They said no. But then they said that they were still part of China. They said that this was because the Han people were, “Very accepting of the other races allowed to be in China”.
I won’t be surprised when those “Other races” rebel.
Reply
+2Gaad! says:
Wednesday, September 2, 2009 at 10:23 pm
Actually, I think you need to looky more closely at the history between Manchuria and Zhong Yuan (中原). It didn’t begin simply because of or at the time of the Qing Manchurian conquest. Da history goes back many a long time ago.
Dey are like when da Roman Empire had black Caesars or da Egyptians had black Pharaohs, but which da sneaky bugger white colonialists conveniently forgeta mention for da lasta hundred years or so.
Reply
+1pimp_war says:
Thursday, September 3, 2009 at 12:10 pm
I once made the mistake of referring to Ghenghis Khan as a Mongolian. Be careful with that one.
Reply
The DJ says:
Wednesday, October 21, 2009 at 10:55 pm
Shenyang stand up!
Reply
-5Gram (SF/Den?) says:
Wednesday, September 2, 2009 at 7:00 pm
A real, real shame that that disgusting scum whore of a mother is actually still alive. She should be cut into pieces alive.
Reply
-4lol says:
Wednesday, September 2, 2009 at 7:06 pm
true that. kill all those who dislike smelly chinks!
spitting on the street and having small dicks rules supreme!
Reply
-4Brutus says:
Wednesday, September 2, 2009 at 7:15 pm
Chinese people are incapable of responsibility on all levels, they lack morals, ethics and a soul. No wonder they don’t fit in when they move abroad and end up living in Chinatowns where they exploit each other in sweatshops or threaten each other into slave labor.
Google chinese morecambe bay
Reply
+3Gaad! says:
Wednesday, September 2, 2009 at 9:55 pm
I’m sure you’re just full of morals, ethics and a soul ain’t ya. And if you’re in China, I wonder what you’re doing here?
Reply
-1Uncle B says:
Wednesday, September 2, 2009 at 7:18 pm
Part of the “Ugliness” of America is its promiscuity and sexual practices They are well known and despised in the greater part of the world. America has been propagandized to accept much that the rest of the world considers repulsive, much that discourages many religious leaders, much that invites the label,”The New Babylon” for America! Notice, the jews and their ‘race restricted’ breeding practices, the pure blood French Canadians and their racially slanted, linguistically slanted, breeding rites, the Moslem’s sects who prefer interbreeding to racial mixing, Most Asians do not like “hairy monkey’ whites or Negroes for mates, the end result simply does not fit their social norms at home! It is human nature to stick to your own kind, social level, economic and educational background. Familiarity of custom makes for longer term compatibilities! Much of the U.S. male black population, statistically speaking spend time in prison, have multiple female relationships and large disconnected families – Some white guys do this too, but can hide it more easily! A brown woman will likely have a brown child that fits her social milieu, not so a white woman with black child, she is the object of rejection and derision on both sides, black and white! America will have its promiscuity as long as soldiers are needed, and that will be fore a long time, and the Chinese will reject anamalies of race as long as they have population problems to begin with, and much of the world will go on as the Jews have for Centuries, controlling their own, and promiscuous and irresponsible towards goyem, or others! Humanity has races due to this propensity in the first place!
Reply
shenyang says:
Wednesday, September 2, 2009 at 7:40 pm
What does America have to do with this?
Reply
Mike Fish says:
Wednesday, September 2, 2009 at 8:19 pm
I’m impressed… I assumed the KKK couldn’t even operate computers let alone type a complete paragraph. Good job Uncle B(funny your name rhymes with cunt in Chinese, coincidence? I think not)!
Reply
-4Black Dicks In Chinese Chicks says:
Wednesday, September 2, 2009 at 7:40 pm
Black American Dick = 12 inches
Chinky Yellow Dick = 3 inches
Chinese Pussy is tight, black spunk inside Chinky womb.
Yo Mama make beautiful baby.
Conclusion: Chinese need more genetic material from blacks and whites in them, people always say mixed blood are more beautiful/clever. Its well known FACT.
Chinese people are only really 50% evolutionary completed. They need other race to weed out their bad retarded genes.
100% Chinese is obviously not a higher level of homo sapien. The pictures of the girl prove it. Mixed Chinese / Black and she is fucking hot, smart and very very cool.
Her mama knew exactly what she was doing when she wanted some negro juice in her. Clever woman. Respect.
Reply
shenyang says:
Wednesday, September 2, 2009 at 8:00 pm
You give respect to a woman for cheating on her husband?
Reply
Rasxcaljaxx says:
Wednesday, November 4, 2009 at 5:12 am
He’s 3 inch yellow dick was clearly too small!
Reply
+1Ming says:
Wednesday, September 2, 2009 at 9:32 pm
The irony, is that there are more Chinese man marry to African woman then the other way around.
What an irony hu?
Reply
+4Gaad! says:
Wednesday, September 2, 2009 at 10:36 pm
NO, NO, NO! He just repects his motha very much, for obvious reasons of course.
Reply
+3J says:
Thursday, September 3, 2009 at 8:11 am
How do you know? Did you go and inspect a lot of Chinese dicks here in China? I bet you got a really good and up close look and perhaps sucked a few of them?
“There are blacks and there are niggers. The niggers have got to go.” – Chris Rock
Reply
Mike Fish says:
Wednesday, September 2, 2009 at 8:26 pm
Remember, people in any country, who sit in front of computers all day and night, living in their artificial worlds of digital farms and virtual combat, commenting on the inanity of other places they’ve never been to, and never will, should probably be ignored… I guess that includes me.
Reply
+1pimp_war says:
Wednesday, September 2, 2009 at 8:32 pm
For a black person, her singing sucks. So I guess that part is the Chinese in her.
I think Chinese people generally just need to start intermarrying with other races more so the country would start becoming more laid back. For example if you got a Chinese person to have children with a Mexican or some other type of Latino person, you’re gonna get some Filipino kids. Filipinos are the coolest and most laid back people on the earth.
I know of some other Black-Chinese/ Chinese-black people back in the states. The black traits are generally more dominant. The worst that happens with that mixture is that you get these nerdy otaku black people.
The white-chinese mixes are really common. I know a lot of those types of people too. They tend to just look and act more like white people. This world doesn’t need anymore of white people.
I know of a few Chinese-Middle Eastern/Arabic people. Basicaly, what you get with that are more Uighurs/Central ASians. I’ve met quite a few of those krygyzstan, kazakhstan, uzbekistan guys and they all seem pretty cool. Only problem is probably their religion.
If you start mixing Chinese people with Mongolians you get Koreans. If you mix Chinese people with Koreans you get Japanese people. If you mix Chinese people with Japanese you get Taiwanese people….I think you get the picture. The world will just be better with more interbreeding.
Oh yeah, a Chinese person and a Jew = super cheap. I guess you can look at it another way and say that this mixture can give you a person that’s really good with money.
Reply
Gaad! says:
Wednesday, September 2, 2009 at 9:58 pm
Hhu?! And which pimp made you?
Reply
+1funny-orient says:
Thursday, September 3, 2009 at 5:02 am
funny! lol.
how about a norwegian with a black father and Afghan mother interbred with a german woman of Indonesian and Aborigine descent?
Reply
+1pimp_war says:
Thursday, September 3, 2009 at 10:28 am
That gives you a Malaysian.
Reply
+1Fike2308 says:
Thursday, September 3, 2009 at 8:18 am
Pimp war is funny….and right.
I love Fillipinos.
Reply
Max says:
Sunday, October 25, 2009 at 10:08 pm
roflmao><
Reply
mreggbutt says:
Tuesday, November 3, 2009 at 5:07 am
the jews is here its called hong kong
Reply
John Yao says:
Wednesday, September 2, 2009 at 8:47 pm
Although I’m not condoning her mother’s action, this racism against blacks just go to show you that so many in China are WHITEWASHED by the stupid white/Jews/Hollywood people to believing that “White is right”.
Reply
+1Gaad! says:
Wednesday, September 2, 2009 at 10:00 pm
Wow! A Chinese KKK? Arrrrgh da KKK are spreaaading!
Reply
pimp_war says:
Thursday, September 3, 2009 at 10:40 am
The alliance of Chinese and Jews is bound to happen sooner or later because of their love for money.
Reply
Singapore Short Stories says:
Wednesday, September 2, 2009 at 10:03 pm
We should respect each individual, such taunting are unwarranted.
Reply
+4krdr says:
Wednesday, September 2, 2009 at 10:07 pm
Fight racism! Fight racism!
Reply
+5capt. nullz whatever says:
Wednesday, September 2, 2009 at 10:41 pm
wow the commentary on the racist commentaries is … racist. I love the human race :) not.
Reply
-6brzr says:
Wednesday, September 2, 2009 at 10:44 pm
i hate chinese people
i don’t hate black people
this chick is hotter than 99% of chinese beasts
and yes, at least in the US, black people are much more highly regarded. most people hate chinese and assume (usually correctly) that they don’t speak english or have any desire to assimilate
Reply
+3A says:
Thursday, September 3, 2009 at 11:37 am
I hate you. just you, regardless of your race. You have a low standing in my eyes because of the way you judge others.
Reply
Eurasian Sensation says:
Thursday, September 3, 2009 at 2:34 pm
@ Brzr: If you hate Chinese people so much, stop hanging around websites that are all about Chinese people. Stick to the websites with naked pictures of your sister.
Reply
-4J says:
Thursday, September 3, 2009 at 3:11 pm
What?!?! Where in the US are you from? Some black ass ghetto neighborhood in the Bronx?
Face it, you hate Chinese because you’re envious of what they have. The average Chinese family VS the average Black family in the US isn’t even close in comparison when it comes to money and family values. Chinese are higher educated where as a black guy even getting into a decent college not based on an athletic scholarship is rare.
The only successful blacks in the US as a whole are musicians and athletes or aka entertainers. That’s all famous/successful blacks are in the US . . . ENTERTAINERS. What a joke. Everytime anyone says anything negative about blacks in America, blacks start playing the race card and gets everyone to back off. Nothing respectable about it at all. Go listen to the Obama NAACP speech and even he says that blacks in the US are a problem.
Assimilate? What have blacks been doing the last hundred years or so? Ebonics, the N word, clothes, style, whigger, etc. Blacks in America are the ones that don’t assimilate and are proud doing it.
You are a moron and have no idea what you’re talking about.
Reply
Shazam says:
Monday, September 7, 2009 at 12:49 am
I’m not sure you know what you’re talking about. Concentrated slavery efforts decimated large portions of African civilization and forced black people to spend centuries beneath everyone else. The abolition of slavery did not free black people from the sentiments people held toward slaves. They’d been treated as less-than-human so that slave owners could justify their actions to themselves and to others, and this view has persisted to their children, grandchildren, and so on. The end result is that white people have a vested interest in keeping black people down; the vague notion that they are securing the future for their progeny. This has manifested itself in many ways; including poor funding for areas where black people or other minorities live, racial police profiling that nets more black offenders and harsher sentences doled out to black prisoners, and racist hiring policies in higher paying jobs. If there is a surplus of black entertainers, it is because that is, historically, a job white people are comfortable seeing black people hold.
Fortunately, these tendencies ease a little with every generation, and we see more black people doing well and finding opportunity. You are sad and racist if you think that there is some genetic predisposition that causes black people to want to live in shitty conditions.
Reply
+2Carlos says:
Monday, October 19, 2009 at 7:35 am
This is interesting. Why would any Black person be envious or jealous of someone Chinese. This pathetic tiny mindset just proves how childish and immature many Chinese people are.
First of all let me address, we do assimilate, but there is one thing, you probably don’t know or not educated enough to understand. Do we have to assimilate to the way Whites want? Does that mean the US is the land of Whites and therefore, we have to act and do as they say, otherwise we are the ones that are going against the flow?
America is a multi-cultural, multi-ethnic nation, therefore we have the right to have our own style and culture. Why is that Asians always want to kiss up to Whites, forget their own culture and act like them, try so hard to forget where they come from and try to adopt a banana OC type, “please accept me, I am trying so hard to be like you.” Blacks used to be like that until the 60’s and we got tired of trying to emulate Whites and learned how to embrace our beautiful culture. I think that is the underlying problem with many Whites is that we do often go in an opposite direction or being a rebel if you like. Because for the last 300+ years, we have been acting and assimilating “White America.” Now it is time for us to be Americans, NOT White Americans. There is no such thing!
And it doesn’t matter where a person achieves success or what field as long as they or not breaking the law. Being an entertainer is not a joke or are you jealous that you don’t have the talent of a Kobe Bryant or a Russel Simmons? Or is that you just despise Blacks so much, that when you see a financially successful Blacks, it just burns you?
No one is saying there isn’t a problem in the Black community, but before you run your mouth, understand the reasons, the history as to how that became, how it evolved. So if you don’t understand what Obama said why he said or if you don’t have never lived in a Black community, then you need to take yourself out of the argument.
Asians are strangers to playing the race card, so let’s not go there. I think guys like you are jealous because perhaps some brother got the girl that you wanted and he was very suave and cool, but you just couldn’t compete. Or some brother making more cash or being taller than you, hence, the childish outburst and hostility.
Reply
Rosebelle says:
Thursday, October 1, 2009 at 11:07 pm
Hmmm…not sure which part of the U.S. you’re from. I also hope my grammar isn’t too difficult for you to understand because according to your assumption, I don’t speak English.
Reply
-1tk 4 lyfe says:
Wednesday, September 2, 2009 at 10:48 pm
the brotha hit it and then quit it! props! we dont love them ho’s, beechez aint shiet but hoz & trix!!! take that take that take that…
Reply
capt. nullz whatever says:
Wednesday, September 2, 2009 at 10:50 pm
Haha good brzr. I don’t care what other people think, especially if it’s stupid.
You just want to stir hatred in me or whatever in order to make yourself feel good and forget that you are probably stuck in China. Or maybe you are just lonely. I feel for you racists.
If it makes you all feel better murder me?
Reply
-6SF (Den/Gram?) says:
Wednesday, September 2, 2009 at 10:53 pm
If someone hurries up and slits that throat of hers before she uses that diseased womb of hers, along with that piece of trash she calls a mother, this will all be over, nice and clean.
Reply
+4capt. nullz whatever says:
Wednesday, September 2, 2009 at 11:04 pm
the difference between China and the US is simply that the US is better when it comes to multiculturlism as they have more diversity and thus bettern oppurtinitines for people to learn to become less ignorant, about other people.
We’re all people.
I HOPE the Chinese media use this to promote more understanding in order to lessening the stupid ignorance. They better. If they don’t, I’m calling in the alien overlords.
I fucking don’t understand why people do this. It’s so illogical, to live in ignorance. Look at this thread, back and forth ignorance. Chinese defending racism with accusation of racism; the hatred and blaming of Jews, so typical. FUCK I HATE LIFE.
Reply
-2mike says:
Thursday, September 3, 2009 at 2:44 am
you know why? most black people in China are into drug dealing and illegal forex exchange, and that’s how chinese people stereotype them as, it’s like one bad apple makes all the apple go bad.
Reply
-3J says:
Thursday, September 3, 2009 at 2:18 pm
True. If you ever get a chance, go to Beijing’s SanLiTuen and you can smell the stench of marijuana from the bar streets. Inside, majority are African or African Americans.
Reply
+1Mike Fish says:
Friday, September 4, 2009 at 9:20 am
Go to the right place in the U.S. and every Chinese person there would be the worst kind of uneducated, uncooth Chinese person too. If you pick and choose, you see what you want. Also, it’s a bar street, everyone there is there for a drug, whether it’s alcohol, tobacco, or herb, you ignorant hypcritical moron.
Reply
-2Eric says:
Friday, September 4, 2009 at 1:50 am
US media is so racist free?
have you seen how asians are portrayed in US media?
Reply
+2Chen says:
Friday, September 4, 2009 at 9:07 pm
You know, the fact that somebody else is stupid is no excuse for you being stupid as well.
Reply
+1J says:
Wednesday, September 2, 2009 at 11:13 pm
There’s racism in every single corner of the world. There’s no doubt about it. I seriously doubt that any one country is more racist than the next.
Look at Europe. Eastern European politicans are getting into office preaching hate. UK has problems with Arabs/Pakistanis amongst other things, that’s well documented. The French won’t respect Muslim women wearing veils. (Considering making it illegal.)
Africa . . . don’t really need to mention it. It’s VERY well documented . . .
Americas, the US leads the world as far as tolerance goes, but there’s still shit load of racism that exists. Obama winning Presidency and members of racist groups multiply like crazy. And historically speaking, the US might of been the worst. Wiping out Native Americans and around 1920s had I think 9 million members in the Ku Klux Klan.
S. America is just as bad as Africa.
Asia . . . everyone hates each other, with the Japanese being the most hated by its neighbors.
Racism is everywhere. However, we must realize that most people in the world are good neutral people. They go to work, come home, eat, sleep, shit and that’s their life.
It’s the low life hicks of the world that stand out and embarass the shit out of their homeland.
FUCK HICK ALL AROUND THE WORLD
Reply
-1VeerLeft says:
Wednesday, September 2, 2009 at 11:31 pm
Using racism to combat racism? Wow… some of these posts are very similar to the ones on the Chinese BBS… Be aware that the internet is full of hateful, bile filled posts.
The true scandal here is that the fucking TV host on a Talent show asks her about her dad, instead of about her career aspirations or such.
Institutionally supported racism.
Reply
+1J says:
Thursday, September 3, 2009 at 8:08 am
Wow guy . . . your reading comprehension astounds me. Please go to your local book store and buy yourself a few decent english literature books so that you may enlighten yourself in the ways of the educated.
Has anyone of you entertained the thought that perhaps the TV show asked about her history so that the viewers can understand why she’s “black” and yet “Chinese”.
Trust me on this one, I’ve met some dumb ass Chinese people in China where they’ll only judge on appearances and try as they may, they won’t understand why/how I can speak Chinese/English/Japanese.
It’s quite astounding.
Reply
VeerLeft says:
Thursday, September 3, 2009 at 3:05 pm
Not you J. Wasn’t meant to be a reply to you. Just hit the wrong highlighted text. Sorry.
Reply
+3JD says:
Wednesday, September 2, 2009 at 11:21 pm
Come to the U.S! You will be treated as the amazing beauty that you are!! I am a former fashion model who has worked in New York and LA. Women like you are exotic, and celebrated!
The comments from the select small-minded Chinese are no better than that actions of Adolf Hitler. There IS NO superior race! Our world is only as good as all of God’s creations (and Buddha if you believe). He only creates perfection, and that is personified in Lou Jing!
Reply
-1GermanChinese says:
Wednesday, September 2, 2009 at 11:41 pm
A black skin is just against Chinas (and its subcultures Japan, Korea & Vietnam) traditional view of female beauty. It has nothing to do with racism. Many chinese girls and women even don’t like sunlight and wear an umbrella against it.
White/pale skin is just the best looking.
Reply
+2Sophia says:
Thursday, September 3, 2009 at 12:04 am
Racism is hard to combat in a country where everyone has the same skin color. Most of those people have never met or even seen a black person in real life. Whenever Chinese people, even in the US, say “american” they mean white people and when they talk about black americans, they say “black people”. It’s infuriating and sadly something that will take a while to correct. We can start by not putting only white people on a pedestal.
Having said all that, Lou Jing is soooooooooooooooooo pretty. I wish she would comes to the states. We know how to appreciate that kind of beauty here. :)
Reply
+1Mark says:
Thursday, September 3, 2009 at 1:32 am
Chinasmack: Racism? Sex? Idolatry? I’m there!
Reply
Mark says:
Thursday, September 3, 2009 at 1:33 am
Haha sorry, I meant adultery. Too much pagan heavy metal.
Reply
+2SauLaan says:
Thursday, September 3, 2009 at 1:37 am
Wow, you guys are unbelievably racist. From this I can see that China is truly not ready to join the world.
Who cares what colour ones skin is??? Seriously, you guys are being an embarrassment to China, making all Chinese look as if they’re from the 14th century.
I know this is not true, so please do not act as if it is!!
Reply
SauLaan says:
Thursday, September 3, 2009 at 1:39 am
And another thing, if you really are stuck in the 14th century in your mind, have the intelligence to keep your thoughts to yourself!!
Privately, you can continue to be racist, but publicly, for China’s sake, pretend to be modern!!
Reply
-2mike says:
Thursday, September 3, 2009 at 2:33 am
if i am a racist for against immigration to china or black men going to china committing adultery and leaving bastard babies then let me fucking be a racist.
Reply
+2SauLaan says:
Thursday, September 3, 2009 at 2:39 am
ha, even as hundreds of citizens are committing adultery at this very moment, suddenly you’re against adultery…
if it is a black person, right?
good luck trying to get a high reputation for China. Like I said, think it privately but don’t make it obvious to westerns that Chinese people can’t handle globalization!
Reply
-4mike says:
Thursday, September 3, 2009 at 2:49 am
you don’t goto a foreign country and commit adultery, that’s a ultimate disrespect for the host country, and plus black people don’t have a high reputation in china due to illegal drug dealing and illegal currency exchange. there’s also more than 100,000 illegal blacks in guangzhou you still wonder why chinese discriminate against blacks so bad?
Reply
+4SauLaan says:
Thursday, September 3, 2009 at 4:49 am
Yippee, come to China but don’t have sex oh and don’t come if you’re from Africa except we’ll come to you and make money off you. But please, don’t buy our guys any beer or wink at them or anything, just hand them money and walk away.
Really respectful.
If there’re a hundred illegal people ANYwhere in China it’s the PAP and Border Patrols’ fault, deal with it!
PAP don’t have any problem rounding up people in Shishou (well in Shishou actually the people rounded up the PAP, but….okay how about Kangding or something) so if there’s – how many – one hundred THOUSAND (??) illegals in GZ, it’s cuz the ZF WANTS them there.
You wanna blame someone, blame the right source.
+2The John says:
Thursday, September 3, 2009 at 12:15 pm
I agree with SauLaan,
What you don’t know is that organized crime in China is controlled by the locals and a lot of people get benefits. Even, if you want to get involved, YOU MUST GO THROUGH THE LOCALS. So, if someone is committing an illegal crime in China (and making big money), there is a Chinese person involved. I worked in several bars. Although, I wasn’t involved in any illegal engagements. I can say that drug dealing was usually done in a lot of places. Police were given “financial rewards,” every month.
Some Chinese people fail to realize that local governments know and see EVERYTHING! If there are a lot of “illegal blacks in GZ,” they are there for a reason and if they are getting away with drug trafficking, who are they selling it to? CHINESE ARE INVOLVED AS WELL!
I hate it when people use some idiots in GZ, to justify their racism. How about all of the black guys in China that are not drug dealers? I’m sure there are quite a few.
+1Mike Fish says:
Friday, September 4, 2009 at 9:12 am
If being an illegal immigrant is a fair reason for being discriminated against, then you’ve just justified all the anti-Chinese comments on here. Those illegal blacks(when was black a nationality) from numerous African countries that reside in Guanzghou might add up to several thousand at most. There are that many illegal Chinese in one city in the US alone. Stick your ignorant head back up your ignorant ass.
-1Carlos says:
Friday, October 23, 2009 at 7:01 am
You’re not Chinese, so who cares about your opinion?
Reply
yah says:
Monday, November 2, 2009 at 6:57 am
are you seriously that much of a dick.
Reply
-2Ras says:
Tuesday, November 3, 2009 at 5:06 pm
You are racist because your eyes are still half closed maybe one day when you guys have the same eye shape(you know like fully opened eyes instead of like someone squinting at he sun)and can see properly then you’ll realise we are all the same oh I forgot you guys have little things.
Reply
sofa_king says:
Thursday, September 3, 2009 at 12:14 pm
Welcome to China!
Reply
-2mike says:
Thursday, September 3, 2009 at 2:35 am
“1. My father is American, not African.”
black people in america = African-American
this dumb bitch just discriminate against her don’t give a shit about her daddy.
Reply
+1SauLaan says:
Thursday, September 3, 2009 at 2:40 am
But sure lets kick all foreigners out, stop doing business,
and go back behind the Wall, right?
Or…outlaw love?
Time to grow up and join the 21st Century with the rest of enlightened citizens.
Reply
-2mike says:
Thursday, September 3, 2009 at 2:52 am
sorry man i am grown up, i just don’t buy the multi-cultured crap like rest of you brainwashed folks do.
http://www.dailymail.co.uk/news/article-504354/White-Britons-minority-dozen-towns-30-years.html
Reply
+3blametheparents says:
Thursday, September 3, 2009 at 12:55 pm
aha! The Daily Mail! the well known liberal, intellectual newspapare of choice! Must be true then…
Reply
+1poor thing says:
Thursday, September 3, 2009 at 3:52 am
enlightened me more about this love you speak of in your world
Reply
+2Yin says:
Thursday, September 3, 2009 at 2:55 am
Enlightened citizens? Heh, racism is making a comeback in Europe due to non-white immigration; America already has Stormfront and their numbers are growing. We’ll see what happens in eventuality.
Reply
+1ziggypop says:
Thursday, September 3, 2009 at 3:52 am
The girl is beautiful.
Reply
+2ST says:
Thursday, September 3, 2009 at 3:57 am
She is beautiful! Can’t sing to save her life but she is quite stunning looking.
Reply
+1lostinsz says:
Thursday, September 3, 2009 at 4:19 am
Dont know where this fits in, but when wandering through a local craft market in Fuzhou a few years ago, I came upon a copy of Mein Kampf which had been translated into Manadarin. If you want white on black murders, go to St Petersburg.
Reply
-1SauLaan says:
Thursday, September 3, 2009 at 4:52 am
By the way I support Lou Jing and her mother 100,000%, you guys are despicable to be so stupidly cruel to two fellow citizens. Like YOU’VE never had sex with anyone and couldn’t have gotten pregnant “out of wedlock” [what is this now, Puritan England??? Jesus.]
She’s a beautiful Chinese citizen and I can tell by the way you treat her how you’d treat some so-called “55 minorities” person, probably just as bad. Sigh. Too far to go yet. Please stop embarrassing us in front of the world. You want to be “yesterday,” then yam cha with an older person and grumble about dark-skinned babies while the rest of us emjoy become a superpower with a peaceful rise.
Reply
+3Yin says:
Thursday, September 3, 2009 at 5:15 am
I don’t think a society needs to be Puritan England to look down on adultery and abandonment. I’m not saying the woman and her child doesn’t deserve sympathy – they do. And I’m not saying that it’s fair to blame the girl for her parents’ deeds – it’s not. But this is not simply a case of people being too Puritan, unless you care nothing about family values at all.
Reply
-2SauLaan says:
Thursday, September 3, 2009 at 5:17 am
Yeah but the only reason anyone cares is because the father was black.
Reply
Yin says:
Thursday, September 3, 2009 at 5:44 am
Actually, the reason anyone cares is because she is 1) a celebrity and 2) exotic (so yes, the fact that her father was black does make a difference, but it’s not the only reason).
Reply
+3J says:
Thursday, September 3, 2009 at 8:28 am
I doubt it. Adultery is looked down upon by most civilized countries on this planet. But I’ll also say that there’s definitely a double standard in the world.
When men are sluts and go out and FUCK a lot of women, they’re considered “the man” and are respected by other men in society to a certain degree for being able to charm women.
However, when a women does it, she’s a bitch, slut, whore, hoe, especially Asian women where society still has this demand on women here to be pure and free of taint.
There’s definitely other double standards that exist out here as well. Look at Korea where women beating is still more or less socially acceptable or Japan where women just get shit wages and socially acceptable abuse of women is part of society.
Even the US is still sexcist. Women make .70 cents per hour where as the man with the same job would make a dollar.
Let’s face the facts people, this topic is big but not for the right reasons.
Reply
+2J says:
Thursday, September 3, 2009 at 8:20 am
Family values?
The world as a whole is losing the battle on this. Look at the typical American family during World War II and look at it now. DISGUSTING . . .
Look at the family value trends happening here in China, especially Beijing and Shanghai where the one offspring per family rule has destroyed some of the young. SPOILED FUCKS who can’t do anything and won’t do anything besides studying.
In my honest opinion, the world needs to bring back good old fashioned ass beatings. Fear and respect are roughly the same thing if you think about it.
“No on is above an ass whooping.”
-Chris Rock
Reply
Fike2308 says:
Thursday, September 3, 2009 at 8:27 am
Gotta love Chris Rock (Unless you’re Chinese)!
Reply
+2funny-orient says:
Thursday, September 3, 2009 at 4:53 am
having a hit at this girl behind the anonymity provided by the internet is something every fu&king person can afford to do. if the chinese want to find out how we regard them in africa then they should listen. just as the N. Koreans see Hilary Clinton to be a funny woman, thats the same way we see the chinese to be funny people but all the same respect them as humans. there are many living here and are well-vexed in fake products and importation of useless stuff into africa. those here are involved in several shady deals and still see themselves to be better than others. but we give them space to breath.
i only blame that idiot of a black man who has brought this insult upon this girl. no wonder he’s from the US.
Reply
+1SauLaan says:
Thursday, September 3, 2009 at 5:46 am
(\__/)
(=’.'=)
(”)_(”) Down with Racism
Reply
Rosebelle says:
Thursday, October 1, 2009 at 11:17 pm
You’re the second person that I came across that can do art like this. The other one was a picture of a girl leaning on her hand. Nice.
Reply
+2funny-orient says:
Thursday, September 3, 2009 at 5:57 am
my teacher once said that literacy doesnt mean education. you may be able to read and write but i dont think you are educated enought to comment on such a delicate issue as this. it is natural for one to defend his/her race but u really need to know that all those stupid news u hear of are just a fraction of africans killing themselves with spoonsorhip money from the western countries. see the kettle call the pot black.
Reply
Fike2308 says:
Thursday, September 3, 2009 at 6:33 am
I think at least half of the racist comments come from jealous Chinese girls.
Reply
-3do not want says:
Thursday, September 3, 2009 at 8:55 am
lol you for reals?
go look up the ideal minority, its often written in sociology books.
go look at the majority of people in jail.
look up the stats on who is on welfare.
strong suspect that you are in fact a a black
Reply
-2Fike2308 says:
Thursday, September 3, 2009 at 10:32 am
1.) I was half-joking/half-serious
2.) Ok, there are some black people in jail and on welfare…so what?
3.) How can Chinese people be racist towards blacks while simultaneously adoring the NBA and Kobe Bryant? I don’t understand.
4.) I’m not black, I’m white….who cares?
5.) “Strong suspect that you are in fact” one of the jealous Chinese girls I was joking about.
Reply
-4do not want says:
Thursday, September 3, 2009 at 11:19 am
1) ok
2) Blacks destorys the economy and society, I do not like my tax dollars paying for the baby popping way.
(refer to majority of sociology books, and look up the ideal minority. It states that Asians are the ideal minority in society.)
3)Thats cause the do not have blacks in China causing havoc. Liking them and having them is two different cases.
4)I assume you are either a wigger, or a closet wigger.
5) Sorry ain’t a chick, I am a dude.
Reply
-2Fike2308 says:
Thursday, September 3, 2009 at 11:23 am
I agree that an asian minority in society is probably much better than an asian majority.
Wigger?
Not really….just a white guy from California…more into surf/beach/rock culture.
+2Eurasian Sensation says:
Thursday, September 3, 2009 at 2:28 pm
@ do not want:
“Blacks destroy the economy and society”? Blacks built the American economy and society… without hundreds of years of black people working for free, America would have been nowhere.
Go look up the history of Western subjugation of African, the American slave trade and hundreds of years of prejudice and discrimination. Then have a think about why black people are overrepresented in prison and welfare.
I strongly suspect you have shit for brains.
+2Jean says:
Thursday, September 3, 2009 at 6:36 am
My parents are Chinese and I can say that she’s hot! ’nuff said.
Reply
+1kodabar says:
Thursday, September 3, 2009 at 7:21 am
Wow. So she appears on a TV show where she will be judged on her appearance. And then she doesn’t like it when she is judged on her appearance. Hmmm.
Yeah, okay, she shouldn’t be condemned for her mother’s behaviour, but she surely can’t decide to be judged on her looks and then complain when she is.
Oh and I’m British and not Chinese or of Chinese descent.
Reply
yah says:
Monday, November 2, 2009 at 7:10 am
she was meant to be judged on her presentation, not racially attacked.
Reply
+1Steven says:
Thursday, September 3, 2009 at 7:24 am
That is just terrible that things like this still exist =O I think China is going through the American phases and they are right now in the 1930-70s. Poor girl who had no decision in what she would be
Reply
+4Fred says:
Thursday, September 3, 2009 at 9:00 am
Good work, CHINASMACK!
Over 200 hits in just a few days.
Nothing will generate traffic better than topics involving Chinese women having sex with foreigners especially if the foreigners are black.
This topic allows every idiot and his mother to make asinine comments regarding blacks – bad; and Chinese women – Chinese women with blacks – very bad.
May I propose a title for your next topic: “Raped Chinese women give birth to Japanese war babies.”
I’m sure this will generate traffic for your site but in inverse proportion to the intelligence of the comments.
Reply
+1Fike2308 says:
Thursday, September 3, 2009 at 9:08 am
“Raped Chinese women give birth to Japanese war babies.”
Can’t wait to read it!
Reply
+4Rick in China says:
Thursday, September 3, 2009 at 1:40 pm
That must be one hell of a long gestation period.
Reply
+2Jay says:
Thursday, September 3, 2009 at 9:39 am
I’m quite surprised by so many Chinese netizens immature view of race. It is instructive how upset so many are about this. Of course extramarital affairs are bad but it’s extremely common in China. It’s only because the father was a foreigner and a black that people seem so upset. What bald racism! The young lady is very beautiful and I hope she doesn’t let the lowlife netizens get her down. If China is too rough on her I hope she will come to the US. We would welcome her.
Reply
-1Ming says:
Thursday, September 3, 2009 at 10:37 pm
The only thing I disagree you with, is that the perception of beauty standard is different all over the world. From my understanding, there is a long standing beauty standard in China, and much of the eastern world that lighter skin tone is considered beauty, meanwhile darker skin tone is consider ugly. One of the reason of this is that during imperial time, people with light skin tone are associated as people with office or business jobs. People with dark skin tone are associated as hard labor or farmers who have to work long hours in the Sun. Other asian can back me up on this point.
Therefore, I do not think it is racists for Chinese or other asian to considered dark skin tone as ugly verse light skin tone as beauty. If a man have to have sex with every women of every color just to proof that he is not a racist, then this world will be filled with racists.
PS: I think most of the Chinese netizens were piss that her mother would cheated on her ex-husband with a foreigners, worst of all a black man which in China is considered ugly.
PSS: Even before this story, Chinese perception of black beauty has always been negative. Dark skin tone simplely have never been considered to be a beauty standard. I DARE say that this rule also apply to: south asian, SEA, and even some Arb and latino with dark skin tone. I am not going to lie, racial discrimination is bad. But I dont think dating discrimination is part of racial discrimination. In contrast, plenty of western woman refuse to date asian man. Do we go bitch about it and cry racist?
PSSS: And I do agree with you that she would have a easier life in the US then China due to her skin color.
Reply
Fred says:
Friday, September 4, 2009 at 1:55 am
@ Ming
Point of information.
PS in letters stands for post scriptum, or postscript.
post – prefix – after in time or order
PPS would be post, post scriptum
Reply
+1LMAO says:
Thursday, September 3, 2009 at 10:13 am
OMG those girls sing so freaking horribly… JUST MY OPINION but Chinese (actually all tonal languages) are not suitable for singing.
Reply
+1pimp_war says:
Thursday, September 3, 2009 at 10:31 am
I wonder if this girl can dance though. If she were part Latino, she’d probably sing pretty well. Just listen to some Filipinos sing and you’ll know what I mean.
Reply
+1Fike2308 says:
Thursday, September 3, 2009 at 11:01 am
Seriously, this singing is AWFUL!
The only way this would be American TV (like American Idol) would for people to laugh at and ridicule.
I don’t think most Chinese people can differentiate between what qualifies as good music and what qualifies as shit.
Reply
+1Carlos says:
Friday, October 23, 2009 at 6:38 am
Without a doubt. She is quite beautiful, but can’t sing her way out of a shoe box, but most Chinese or Asians don’t know how to sing or have a clue to what real singing is all about. I am not talking about their traditional music, which they sing quite well, but when they venture into the pop world, like the Japanese(Gawd, awful)the Chinese way of singing pop is over the top unpleasant and annoying is an understatement. Chinese need to overcome their racists, xenophobia fears and work on their singing abilities.
Reply
capt. nullz whatever says:
Thursday, September 3, 2009 at 10:28 am
Personally I think tonal languages is great for singing. These girls sings like shit though.
And I’m also sick of all the Chinese bashing on here.
I’ve been here like 20 something years and noone gives a fuck about me. America’s got a personal vendetta against me. Sure, I’m pretty weird and shit but society treats me like some sort of trash. itz total alientation sometimes, I just wanna blow my brains out, except I’m too pussy to go though with it.
Reply
+1Fike2308 says:
Thursday, September 3, 2009 at 10:34 am
I’m sure that someone gives a fuck about you.
You need to throw away all of your emo music!!!
Reply
Gaad! says:
Sunday, September 6, 2009 at 11:38 am
Fike is one angry, unsatisfied being.
Reply
Fike2308 says:
Sunday, September 6, 2009 at 12:26 pm
Angry and unsatisfied? Why? Because I made a joke about emo music?
Reply
Gaad! says:
Monday, September 7, 2009 at 12:00 am
Nah, cause u likesy telling peeps what ta do. Usally tis moostly angry und unsatisfied beings qui likesy ta do dat very muchy.
Me thinksy me don’t likesy u anymore. Cutesy ass or no cutsey ass.
Raspberries! Raspberries!
Reply
The Grudge says:
Monday, September 7, 2009 at 12:25 am
Gaad! Does Google Translate supports the language you are using when you write your comments?
Tried it, to no end, unfortunately. :(
As a side note: According to my Bullshit Detector Device, you are undoubtedly Chinese.
One word (one dream?): Fail
Gaa! says:
Monday, September 7, 2009 at 1:09 am
Yipee! Da Grudge wanna join da fun!
What’s a Chinese?
Gaa! says:
Monday, September 7, 2009 at 1:16 am
Btw, da Grudge, u a Daily Mail reader? Good fer u.
+1Mitchell says:
Thursday, September 3, 2009 at 11:21 am
Sorry, but Chanel Iman is waaaay hotter.
Reply
-1sofa_king says:
Thursday, September 3, 2009 at 12:13 pm
I still can’t over seeing a black chick dressed like a fob.
Reply
+3The John says:
Thursday, September 3, 2009 at 12:35 pm
Just want to say, there are several kinds of people replying to this post.
1. Level headed and rational Chinese
2. Level headed and rational Foreigners
(Some really interesting posts from this group)
3. Racist Chinese
4. Racist Foreigners
(Filed Under Ignore: The usual stupidity)
5. Racist Chinese that pretend to be foreigners that curse Chinese.
6. Racist Foreigners that pretend to be Chinese that curse Foreigners.
(Filed Under Ignore: Only want to make others angry. So, if others are angry and speak without thinking, they can prove a point.)
Reply
+1aChinese says:
Thursday, September 3, 2009 at 12:38 pm
There are just as much racism in China as in other places in the world. It’s all based on ignorance, period. Most of these people who post these nasty comments probably have never seen a black person, and they form judgement based on what they read in the media, see in the movies, etc etc. The world needs to come together more to eradicate these ignorances.
Reply
+4Rick in China says:
Thursday, September 3, 2009 at 1:52 pm
RE: “Just as much”
Mainland China has significantly more racism than, say, Hong Kong, in my experience – and I’m sure anyone who frequents both will agree.
As some people have mentioned, it’s a very homogenous society, as a result, it’s natural for people to ‘huddle’ with those who look like they do, and persecute the others.
In many cases that I’ve witnessed, Chinese ‘huddle’ mentality goes like this:
Han sees Minority – will single out based on minority.
Han sees Minority and White – will group with minority and single out against White.
Han sees Minority, other Asian, and White – will take the side of other minority, and sometimes against asian & white, or sometimes with other asian against white (depends).
Han sees Minority, White, and Black – will take the side of Whites over Blacks.
That’s the basic “pecking order” from the Chinese perspective’s I’ve witnessed. This is usually a male-only scale.
Reply
-3hellofriends says:
Friday, September 4, 2009 at 2:44 am
Han sees Minority, White, and Black – will take the side of Whites over Blacks.
You’re clueless. The smart Chinese person would pit the black against the white. Maybe you’re just hanging around assholes and idiots, since they gravitate to the foreign trash ruining China today.
Reply
-1Fike2308 says:
Friday, September 4, 2009 at 10:43 am
Foreign trash ruining China today?
LOL!
Shanghai and Hong Kong are two of the best (if not the best) cities in China and they were pretty much built by WESTERNERS.
Oh, and the computer you are using….what role did China play in the invention of the computer (or any modern technology) ??
Wake up and smell reality.
Reply
+1Alan says:
Saturday, September 5, 2009 at 4:39 pm
Good points Fike2308, but don’t you think that they were also built on the back of exploitation and slavery?
British ruled HK was essentially a police state, with a curfew enforced during the communist riots. It was only in 1992, five years before the handover, that Patten started democratic reforms which is still a hot topic in HK even now in 2009. I can see the hypocrisy in that, and I’m sure the Chinese can as well. Britain suppresses democracy in HK for almost 150 years, then worrying about their precious subjects, decides to introduce reforms.
As for Shanghai I do agree with you it is perhaps the best Mainland city, in terms of being cosmopolitan and VERY easy to live there for a foreigner.
Also on the computers point agree, first prototype developed in Manchester, England, mass marketed by IBM, first discovery of HTTP by Berners lee, the list could go on…
Nice post.
Fike2308 says:
Sunday, September 6, 2009 at 1:50 pm
@ Alan
“Good points Fike2308, but don’t you think that they were also built on the back of exploitation and slavery?”
Probably….I don’t claim to be an expert but what you say sounds reasonable.
+1D says:
Thursday, September 3, 2009 at 12:43 pm
Granted, the mother cheating on her husband is bad, I do not condone that, but the child is innocent. I feel so sorry for her, if it was with another chinese/asian man, it wouldn’t be an issue, cuz she would be born with a chinese-like skin tone, even a caucasian male. but because she is dark-skinned, she is the target for insult and racism.
Reply
+1capt. nullz whatever says:
Thursday, September 3, 2009 at 2:03 pm
hey I waz just kidding earlier. Now I just find the whole thing funny, the diccusino that is. It’s stupid. This website is stupid. I’m stupid. The internet is pretty stupid. Don’t worry, I will be off soon. My mind is made up. I will still be on the internet but chatting on the internet about random shit–while being put on all sorts of lists–is not my cup of tea.
Really, just read the comments. None of it makes much sense if you read it out loud.
Reply
Rangdangdangadingadong says:
Thursday, September 3, 2009 at 3:16 pm
Latest I heard is that is was Obama’s half brother in Shenzhen who’s the Dad.
Reply
-2Evolutionary Trend says:
Thursday, September 3, 2009 at 3:21 pm
“Conclusion: Chinese need more genetic material from blacks and whites in them, people always say mixed blood are more beautiful/clever. Its well known FACT.”
Very True.
Reply
-1Haha says:
Sunday, September 27, 2009 at 8:20 am
“Conclusion: Chinese need more genetic material from blacks and whites in them, people always say mixed blood are more beautiful/clever. Its well known FACT.”
WRONG. Half Chinese half white babies have lower IQs, lower wages and lower grades.
http://img36.imageshack.us/img36/1125/gpaandrace.gif
They also are more likely to face depression and other markers of poor health:
http://findarticles.com/p/articles/mi_m0DXK/is_20_20/ai_111529997/
A new study that involved surveying 90,000 adolescent U.S. students showed that those who considered themselves to be of mixed race were more likely than others to suffer from depression, substance abuse, sleep problems, and various aches and pains.
They are also more likely to be obese:
http://scienceblogs.com/gnxp/2008/08/race_mixing_leading_to_obesity.php
Reply
-1JImmy says:
Saturday, November 7, 2009 at 2:33 am
It is a well known FACT for Eurasians only.
It is also a well known FACT that mixed with blacks is definitely less pretty.
Even Tiger Woods and other rich black men, himself prefers a pure blonde. Black men has the highest rate of interracial marriage because their own kind is less pretty and desirable on bed compared to bondes/orientals.
You just have to surf the the online forums, black men themselves find their own kind less desirable than whiter races.
Reply
Bronze Breeze says:
Saturday, November 7, 2009 at 3:54 am
What another idiot! is this what you want to believe? well listen well you pink man dolly, I am not proud to say this but I have dated loads of your so called white women and I have made very little efforts (if any) in doing so. Some how in your hollow head it is the so called black men that goes after your women. No you are wrong, everyone knows that it is the other way around. Your women simply can’t take their hands of us strong bronze men. I once had this ‘white girl’ as a friend, she’s always pleaded with me to take her to one of our African parties in London. One day I did, the party was happening downstairs when suddenly I noticed this friend was no where to be found, in the head of the party I found my way to one of the upstairs bedrooms and Whoa! there she was, your ‘white woman’ fully spread eagle on her back, one black on top while four other black waited patiently for their turn. there are thousands of stories of this nature involving your white women. As for your comments on our bronzy women being less attractive, com’on get real can’t you see just as us bronzy men are no BugFu*kers so are our bronzy women no surf boards or flat saucers. Throughout history we’ve never gone looking for you the truth is that it is you lots that always come looking for us.
Reply
+3ahahahaha says:
Thursday, September 3, 2009 at 4:19 pm
Racism is born from complete ignorance. So if you are spouting racist comments you simply prove to everyone else that you are not only lack basic education but you know nothing of the world.
People come in all different shades because, surprise surprise, not everyone on this planet looks the same. The hotter the country, the darker the skin will be of the indigenous people because nature determines this.
The only mistakes here are that the mother had the affair whilst married. The only person that should be angry is her husband. It shouldn’t matter what colour skin the guy has, the fact your wife is sleeping with another man is enough. But this is life, things happen, you learn, you move on.
The fact is, she is half chinese and half american and she seems like a very nice girl.
Reply
Alex says:
Thursday, September 3, 2009 at 4:28 pm
I cant believe how vile and spiteful the chinese people are towards this lovely girl because of nothing more than her beautiful dark skin. It cuts me right to the bone to think this mentality is the majority in china. why am i not surprised? once again china has shown its complete naiveity when faced with something slightly out of the ordinary. What a shame that the pure ignorance of the chinese really shines through here, the saddest thing is that I am not surprised. Once again china, you have shown your cards and let yourselves down (again) with this behaviour. You should all be ASHAMED!
Reply
+2Gaad! says:
Thursday, September 3, 2009 at 11:30 pm
Eh…”China”? Does dat include da Uyghur and da Tibetan hommies? How ’bout da Qiangs, da Mongols, da Manchurians or da Hans? Seeesh!
Reply
-3hellofriends says:
Friday, September 4, 2009 at 2:37 am
How about we start lynching you? Shut your mouth and go back to stormfront.
Reply
+2China Fan says:
Thursday, September 3, 2009 at 8:53 pm
She’s hot! Plain & simple & her mother should be very proud for bringing her into the world. Get over it, you racist bigots!
Reply
poor thing says:
Friday, September 4, 2009 at 12:06 am
I agree, her mother should go make more beautiful black/chinese interracial babies.. Since the other one ran away, look for another black guy.
Reply
China Fan says:
Thursday, September 3, 2009 at 8:54 pm
She’s hot! Plain & simple. Her mother should be very proud for bringing her into this world.
Get over it, you racist bigots!
Reply
country is doomed says:
Thursday, September 3, 2009 at 9:21 pm
She should have hit those rediculous Spring Festival Shows where laowai get up and make dicks out of themselves. Her Chinese would rock it!!!
Reply
GuoBao says:
Thursday, September 3, 2009 at 10:05 pm
Can’t believe the Chinese comments either. I think the chick is chocolate goodness incarnate. Quite the hottie.
Reading comments like these always make me wonder if China can ever be a truly civilized country and join the “1st world”. Too many people here need a serious change of thoughts and I would LOVE to see the government doing their part in changing an incredibly racist mentality running amok.
And another thing: Before you write shaite about other people maybe you chould check how your male family members here in China behaves. I read studies showing that 73 percent of married men have or have had affairs. Maybe it’s worse when it’s a woman doing it.
I also bet the netizens flaming her couldn’t get a woman like that in a million years.
Reply
Eric says:
Friday, September 4, 2009 at 2:08 am
why would Netizens would want her to begin with?
u should be more wise than reading some ” study” about something that you can’t really or truly measure
Reply
-1hellofriends says:
Friday, September 4, 2009 at 2:29 am
I read studies showing that 73 percent of married men have or have had affairs.
You’re full of shit.
Reply
-4SF (Den/Gram?) says:
Thursday, September 3, 2009 at 10:05 pm
That fucking goddamn holier-than-thou face on that fucking cunt of a mother of hers…what I would pay to have the chance to smash it clear in with a hammer.
Reply
+1SauLaan says:
Thursday, September 3, 2009 at 10:09 pm
Yes, like you’ve now smashed China’s good image with a hammer. Nice job, everyone.
Reply
Shocked and Saddened says:
Friday, September 4, 2009 at 6:36 am
wtf
SF
you need to grow up and realise that this is the real world. you can’t go around treating people that way!
leave the girl and here mother in peace.
whats done is dones. its times to get efucated and stop your racsist ignorance!!!
Reply
-2SF (Den/Gram?) says:
Friday, September 4, 2009 at 7:25 am
Shut your fucking mixed-race trash mouth. What you are really defending is yourself and your own mixed-black heritage. “What’s done is done.” I guess that can apply to anything in life, any action, any crime, anything! So we should just forget about any kind of justice system also, since “what’s done is done”.
In any case, what’s done may be done, but in this particular case, with a bit of prompt action (and balls, which is something Chinese don’t have much of unfortunately), the mistake can still be corrected. Both of these walking piles of human trash should be eliminated not only from Chinese society but from the human race itself.
Reply
+2Mike Fish says:
Friday, September 4, 2009 at 10:52 pm
If only sack-less retards like you would post your street address on here we could find out if you could put your money where your mouth is… doubt it.
baby fart mcgee zack says:
Saturday, September 5, 2009 at 8:58 am
well i guess if stupids people have to be eliminated from the face of the earth…there won’t be one chinese left standing.
we all know that chinese are the single,stupidest people on earth.
-1SF (Den/Gram?) says:
Saturday, September 5, 2009 at 7:47 am
Oh Mike Fish, you’re so brave and strong, I guess that’s why you posted your address yourself, to show all the “sack-less retards” here a lesson, and to show them who really has a “sack”. We all appreciate you taking a few minutes from lifting your weights for that…I admit some of us do need to be taught a lesson. Oh, but wait. You didn’t? That’s confusing and surprising. Or maybe not.
Morons who resort to “post your address on the internet” in their arguments are among the most pathetic, hypocritical, and outright idiotic trolls on any forum.
Mike Fish: don’t think to presume anything about others…you know absolutely NOTHING, aside from a bit of text on your screen. And above all, don’t think that you’re anything remotely better, tough guy…just the fact that you’d have the cowardice and lack of self-awareness to post something so detached and juvenile proves that you’re just as much a “sack-less retard” as anyone else here, if not more so.
Reply
Mike Fish says:
Saturday, September 5, 2009 at 9:47 am
You are funny… always getting all riled up and angry. The difference is, without your anonymity, you could not say what you do without getting a serious pounding, not by me, that wasn’t the threat, but by all the other people you intentionally offend. I didn’t threaten you, why would I? I suggested your personal information might attract some people eager to kick your ass though. I know without a doubt I could say all of my comments on here to the face of the person I’m communicating with. There’d be unanimous consensus on here that you couldn’t.
Reply
-1SF (Den/Gram?) says:
Saturday, September 5, 2009 at 10:45 am
Still no address. I guess you’ve found your own “sack-less retard”ness after all. Congratulations. Nothing but troll trash and a coward also, as expected.
Reply
yah says:
Monday, November 2, 2009 at 7:39 am
Your level of intelligent articulation highlights that your not even ignorant just outright full knowingly a ruthless, racist, utter dick, pyscho. The fact that you are informed and still choose to be this way shows you must be the the most stupid muther fucker on the face of this planet.
Reply
Link (baby fart mcgee zack) says:
Saturday, September 5, 2009 at 8:37 am
I guess your mother lost her virginity to a black man as well that’s why your hate this lady so much.
or because you’re so ugly so gross u can’t even dream of having any other girl than a chinese girl…
now you’re jealous that even blacks that u hate so much can get more action than u in your country.
ohhh did i hurt your little feelings???
well too bad that’s how it is around here.
and you’re not ugly and gross then prove me wrong and post your picutre….
you know too well u can’t compete with a black for any girl of any race….u must be pretty pissed.
I bet a chinese girl will choose a black guy over you a 100 times.
Reply
yah says:
Monday, November 2, 2009 at 7:31 am
Who the fuck are you. That’s the second time you’ve left a comment and it’s been ruthless and repulsive. Why don’t you just fuck off and die.
Reply
SauLaan says:
Thursday, September 3, 2009 at 10:08 pm
The very fact that a Chinese girl with dark skin makes news, proves how far China has to go to catch up with the world :(
Like I said, you should keep these thoughts private, but it’s too late–now everyone can see that the Party’s talk of “56 harmonious ethnics” is completely fake.
Also apparently someone is only a citizen until they have dark skin; then national unity doesn’t matter one bit.
Reply
-1hellofriends says:
Friday, September 4, 2009 at 2:33 am
Dude are you stupid or what? The entirety of Southeast Coastal China used to look like that mixed race girl. Probably not as pretty, but the complexion was the same.
Reply
blahblahblah says:
Thursday, September 3, 2009 at 10:35 pm
the very fact you are all commenting on this, that this thing exists, is damn lame.
Reply
Gaad! says:
Thursday, September 3, 2009 at 11:34 pm
Actually, I think it’s mainly the expats and English language China sites that are making this into news and their cause celebre. Hmmmm, fascinating…
Reply
poor thing says:
Friday, September 4, 2009 at 12:08 am
I want to make black-chinese babies too!!!!
Reply
Eric says:
Friday, September 4, 2009 at 1:54 am
isn’t that a racist theme statement ?
Reply
Ray says:
Friday, September 4, 2009 at 7:29 am
No, people have the right to choose who to have sex with. As long as you want to bump that trunk and it’s consensual. More the power to you!
Reply
J says:
Friday, September 4, 2009 at 7:45 am
Unless he was being sarcastic. Then he’d be a complete ass . . .
Reply
Anyway says:
Friday, September 4, 2009 at 12:22 am
Well, she is indeed a lovely girl, and I suspect she may have a bright future.
Indeed, I hope she does.
Just wish she was a little older…
Reply
+1VeerLeft says:
Friday, September 4, 2009 at 10:50 pm
She has a great future… just not in singing. Her voice is HIDEOUS.
Reply
Eric says:
Friday, September 4, 2009 at 2:05 am
ever wonder its always a black guy and chinese gal?
if this girl was product of reverse gender pairing would outcome be the same?
Reply
+1Shocked and Saddened says:
Friday, September 4, 2009 at 5:56 am
I would like to know whether the issue is that her mother had an affair? or that her mother had an affair with a black man? EITHER WAY IT IS DISCRACEFUL THAT ONE WOULD DICRIMINATED AGAINST THIS POOR GIRL FOR EITHER REASON!!!!
My grand mother was born to a black (Guyanese) woman and Chinese father; WWHO WHERE MARRIED!!! We have always been quite proud of our Chinese heritage and I myself have even made steps to learning more about chinese culture. I have not only visited China but, I also take weekly Chinese manderin lessons.
Hearing about the racism which has been aimed at Lou Jing has deeply saddened me. On my visit to China (where I had hoped to one day live) I experienced no racism from the chinese people. Infact I recieved quite a warm welcoming. Therefore I was deeply shocked by the hatred shownb towards Lou Jing.
Why must she be a victim of niave, ignorant racists?
I myself do not agree with infidelity. However, Lou Jing and her mother must not be punished for past mistakes!
Why is it that it is seen as shameful for a chinese woman to have a child with a black man? Many chinese me and women marry white men/women and it is seen as a good thing!
To me, the mixing of different races (black, white, chinese, asian,etc…) is a beautiful thing. Lou Jing is an absoultly stunning young lady. I admire the strength and bravery of her and her mother; no matter what her mothers passed mistakes were.
I feel its time for everybody (not just the Chinese)to get educated about other cultures. This way we can put a stop to ignorant racists!!!
THOSE WHO PUT LOU JING DOWN ABOUT HER HERITAGE SHOULD TAKE A LOOK AT OTHER PLACES AROUND THE WORLD SUCH AS EROUPE, AMERICA, SOTH AMERICA AND THE CARIBBIEAN WHERE PEOPLE CAN BE TOGTHER REGARDLESS OF THE CHARACTER OF THEIR SKIN!!!
Reply
hellofriends says:
Friday, September 4, 2009 at 6:13 am
I was deeply shocked by the hatred shownb towards Lou Jing.
It’s the internet. White people are even worse, look at amren or stormfront.
In fact the Chinese are the least racist.
THOSE WHO PUT LOU JING DOWN ABOUT HER HERITAGE SHOULD TAKE A LOOK AT OTHER PLACES AROUND THE WORLD SUCH AS EROUPE, AMERICA, SOTH AMERICA AND THE CARIBBIEAN WHERE PEOPLE CAN BE TOGTHER REGARDLESS OF THE CHARACTER OF THEIR SKIN!!!
lol, yeah right.
Reply
-1SF (Den/Gram?) says:
Friday, September 4, 2009 at 7:17 am
What an even bigger shock that you yourself are mixed-black. What a complete shock. The loudest, most obnoxious bastards who are so-called “anti-racism” are always in the end really just watching out for their own personal interests and situation.
Reply
baby fart mcgee zack says:
Saturday, September 5, 2009 at 9:03 am
please, how can a chinese person accuse anyone of looking after their only interest and being selfish.
Hello!!! are u even chinese? selfishness is the trademark of chinese people.
on top of that you can add.. institutionalized corruption called “Guanxi”, biggest liers on earth, cheaters, weaklings, pussies, uneducated, loud, dirty, bad mouth,fake…the list can go on .
Reply
Ray says:
Friday, September 4, 2009 at 7:38 am
The point is not to compare which country is the MOST racist. I have a serious problem with whenever an issue arises in China, the Chinese people do not look within themselves for change but try to mask the problem at hand by comparing themselves to other countries to twist the problem at hand to make themselves look like the lesser of two evils.
I am 100% Chinese American, and to become more tolerant you must first examine yourself, make yourself a better person and exude class by treating others how you would like to be treated.
Reply
-2hellofriends says:
Saturday, September 5, 2009 at 1:43 am
Nice guys finish last, the meek inherit nothing, etc.
Chinese people are already the least racist on the planet. If they’re too un-racist whites and blacks will simply walk all over them.
No thank you sir.
Reply
yah says:
Monday, November 2, 2009 at 7:46 am
Where do you get your logic from? Were you dropped on the head as a baby?
Reply
J says:
Friday, September 4, 2009 at 7:50 am
Let’s be real here. Most racist people aren’t active/violent/confrontational racists. A lot of racist people are pure cowards who’ll pull this shit behind your back and never in your face, especially in Asian countries.
If you’re expecting someone on the streets to just jump up in your face and yell out, “FUCK YOU MONKEY!” you’re not being realistic. Even in the west where fights/confrontations are more common, this type of behavior is rare.
Reply
J says:
Friday, September 4, 2009 at 7:51 am
Forgot to mention that with the convenience of the internet, cowards can hide behind their monitors and just let loose. I doubt any of the guys in this forum are willing to get into a fight on this issue.
Reply
-1hellofriends says:
Saturday, September 5, 2009 at 1:45 am
especially in “Asian countries”? Right because “Asian” is a culture, not a huge landmass with no cultural or racial meaning.
Japanese people are probably the most openly racist I have ever met, if they don’t like you you will know it. But most of them are nice people.
Reply
J says:
Saturday, September 5, 2009 at 6:51 pm
I meant what I said. Asian cultures are a lot similar than Western cultures. And Western cultures are similar to each other as well.
Think on it a bit.
Reply
-1Alan says:
Friday, September 4, 2009 at 8:01 am
http://www.nytimes.com/1989/01/08/weekinreview/the-world-china-s-burst-of-rage-a-show-of-racism-and-of-something-more.html
http://app1.chinadaily.com.cn/star/2003/0417/cu18-1.html
It’s sad to see in 2009, that there has not been much progress over these 20 years, since 1989, when it all kicked off in Nanjing.
But I’d take China over South Korea any day, where people spit at you in the street with hostile gazes, just because you are a waygook, and buy into that whole god is Korean bs.
Let the debate go on!!
Reply
+1Mike Fish says:
Friday, September 4, 2009 at 9:03 am
I’d say many of the people on here spewing their vitriol against “Chinese” only have an enlightened view of race because they were taught it. They likely LEARNED to like black or brown people. They’d be xenophobic bigots if they hadn’t been influenced by their formal education or environment. Without that “education”, most of the blinder-wearing-assholes on here would be just as ignorant and exclusionary as the Lou Jing haters.
On another note, people with one baseless bias usually also have a list of others. I’d say if you dug any deeper, you’d find that the Lou Jing black-haters and the Chinasmack-crowd-China-haters likely have other biases in common… anti-gay, anti-Muslim, anti-Semitic, anti-whatever, whichever bias that hasn’t been educated out of them.
Reply
+1Alan says:
Friday, September 4, 2009 at 9:55 am
I’d say if you dug any deeper, you’d find that the Lou Jing black-haters and the Chinasmack-crowd-China-haters likely have other biases in common… anti-gay, anti-Muslim, anti-Semitic, anti-whatever, whichever bias that hasn’t been educated out of them.
Difference being in the west we are educated in a multicultural environment. Not much multi cultural of anything in China. Even the Uighurs are not allowed to dorm in with Han students at unis in China, isn’t that a form of hate/islamophobia MF?
Reply
Gaad! says:
Friday, September 4, 2009 at 11:45 am
Ehhh…you do know that the Han and many other non-muslim ethnic Chinese minorities love their porkies and their booze right? Besides, how do you know that the Uighurs are particularly keen to share with the Han students. Racism and prejudices cut both ways.
Of course in an ideal world with lots of resources for great facilities it would be great for them to be able to share a dorm.
Reply
-2SF (Den/Gram?) says:
Friday, September 4, 2009 at 8:32 pm
You’re right, the “west” is a veritable paradise of racial harmony, simply because it’s a mixing pot. America especially is just plain racism-free…after all, they elected a (half) black president, didn’t they!
You are a true fucking retard. Like all the other idiots here posting in support of this disgusting animal and her off-colored offspring, under the guise of “tolerance”.
Reply
aussie says:
Sunday, September 27, 2009 at 6:02 pm
One day you are going to get bashed by some kkk fuckers and only then are you going to realize that racial hatred is not justifiable.
Reply
+3man from china says:
Friday, September 4, 2009 at 11:33 am
I am from the “KDS”BBS. I want express my opinion to everyone,sorry my poor english .I will try more clearly.
Most comments consider that most chinese people are racist,That is not true.
There is an old adage in china culture,”scandal in family can not show in public”Translate to english is “Don’t wash your dirty linen in public”,adultery is a very big mistake in china tradition.In antiquity china,Women would killed because this mistake. even though in today china,This is still a “dirty linen”.So most chinese consider wash this “dirty linen” in the public is shame on doing.So the bad comments added more and more.
From my side I like this girl,she is beautiful and bravery.I believe this girl will has a beautiful life,But from another side ,I can understood the bad comments.
Reply
KDS TF says:
Friday, September 4, 2009 at 11:57 am
KDS tourism group comes for mark.
What a great mom, great girl, and a great green hat on her father’s head!
Reply
Gaad! says:
Sunday, September 6, 2009 at 7:19 am
Yeah, like u own this site.
Reply
+5Baby Fart Mcgee Zack says:
Friday, September 4, 2009 at 12:02 pm
As a black guy reading these posts i have a smile on my face.
Do I think chinese hate blacks? without a doubt
Do I think chinese are picking on black because they can’t do sh*t about whites? without a doubt.
the reason I’m smiling reading these posts is because chinese being racist to blacks doesn’t bother me at all.
Why? because it didn’t stop me from achieving anything i want here in China ( Family,Job,Love,Fun,Travels…)
why? because statiscally i know as a black man i have more chances of achieving international greatness than any chinese can ever dream of achieving.
why? because I know that chinese people have an inferiority complex ingrained into their mind they can never get rid off.
why? because i know everything being equal a chinese person can’t stand a chance competing with a black person and i mean this on any level.
and yes chinese do resent blacks for a lot of other things…blacks have achieved more positions of power worlwide than chinese can dream of.
US presidency, NASA, UN, CEOs of forture 500, Media, Sport, Culture, Charity, Nobel Prize, Research, Religion and so on and so forth.
In any of these categories blacks beat chinese hands down. Tell me one thing that a chinese has done that a black hasn’t done ( space:a black has been there before a chinese, Nobel Prize: a black has done it before a chinese, SPort:no comment, CEOs: No comment, Education: no comment, Media: no comment…..)
that’s why i’m smiling while reading these posts..because i don’t care.
I have all the fun i want here in China while being black and i’m proud of who i am.
I have great chinese friends and i’m proud of them and i ‘ve been respectful of the culture. i don’t pay attention to all the D-Bags out there having a problem with me..because usually they do it behind your back.
so to all you black people out there in china, chin up.
People are different for a reason and enjoy your blackness.
Chinese know that it’s a dog eats dog world out there when it comes to RACES….and since they can’t do squat about whites so they pick on blacks..
but we all know that whites are doing far worst things here in China than blacks are.seriously the way chinese treat white people goes beyond Master and slave relationship.
Chinese literally adore and worship whites..i know because my roommate was white.
No race has endured what blacks have and no one will achieve what they will. Obama is just the beginning.
Just wait till those little countries in Africa get their acts together and i don’t see how they will be stopped.
So if you want to hate a person because of his skin colour well it’s your choice…go ahead and do that. But Remember Karma does exist.
Peace I’m out.
Reply
-2SF (Den/Gram?) says:
Friday, September 4, 2009 at 8:39 pm
Like most blacks, you have your head so far up your ass that you have no sense of the real world whatsoever. Blacks, better globally than Chinese? That has to be the single most retarded thing spouted on this entire retarded thread. The Chinese might have their problems, but while blacks have been busy throughout history killing each other, sticking branches into anthills for lunch, and getting enslaved due to their oh-so-elevated prowess, the Chinese were busy creating a lot of the cornerstones of asian and now even worldwide civilization, for thousands of years. Absolutely amazing that one would dare show such blatant disrespect for something they clearly don’t have the slightest clue about, but for it to come from the closest thing humanity has to an ape is the real kicker. Go back to the ghetto, sport, and get a second look at your new world order. Moronic dipshit.
Again, the Chinese aren’t perfect, but if one wants to compare them to blacks, they may as well be for all intents and purposes.
Reply
-1poor thing says:
Friday, September 4, 2009 at 9:53 pm
hey hey hey…. thats not right.
even if he’s delusional, he’s happy. Although he shouldnt be spreading delusional ignorance to other people.
Reply
Bronze Breeze says:
Saturday, October 24, 2009 at 5:39 am
Just how on earth can you fetus like little creatures think you are better than we Africans? Can you see? OK I know you all have wearied looking eyes but please. Ok you all have big fat heads but little bodies coupled with long arms making you look more like Chimps than human. Do you know that the phrase ‘Simply the Best’ came from our people? Muhammed Ali ‘I am the Greatest!’ Usein Bolt!? many many more. What else for you idiots to be convinced that we are vastly more better! On neutral ground, Very few white girls will date a Chinese man…Urh!! however white girls fight one another to date African guys he-he-he. Now go back into your frying rice
Reply
J says:
Friday, September 4, 2009 at 9:51 pm
What? Blacks have a better chance of succeeding in life? They’re more respected? Then why are all these Blacks in America bitching and whining about racism all over the world? Are you fuckin’ high?
Yes, the examples you mentioned list a lot of famous black people, but what about the average black person compared to an average Asian? The last time I checked, Blacks have shit ass wages and have morals to match.
So what’s the average Asian family like? Good education, hard working, responsible, respected as a CONTRIBUTING member of society where as a VERY HIGH percentage of blacks in the US need government help and support. Basically beggars without begging and at the same time, DEMAND respect from the very people who feed them and is more prone to breaking the law and inflicting physical violence than any other race on Earth.
Asians have had far more successful empires, inventions, and other accomplishments than blacks have had. The only difference is that they weren’t giving out awards at the time.
Yours is a very Western point of view. Just how much do you really know about Asia?
Proceed and sit back and smile and live in your pitiful existence as the average black in this world continue to beg for assistance from the rest of society and the successful ones being entertainers. Yes . . . be very very proud of yourself and your race’s accomplishments.
Reply
+1baby fart mcgee zack says:
Saturday, September 5, 2009 at 9:22 am
ohhhhh it seems i that i hit a nerve. well guess what..with all that shit going around blacks people they’ve still managed to achieve a lot.
oh yeah of course the average chinese family is better off..according to who? your communist party.
we all know the reality in China people are just as poor as you can find anywhere in Africa.
Haha….we all know why chinese turn out to be geeky at school because of their inferiority complex.
because you cant stand shoulder to shoulder to blacks and whites you lock yourself in your basement and do the one thing you think they can’t take away from you.
Seriously,when have you seen a chinese male in social functions doing anything.
nobody takes you seriously. we rather have an asian woman than an asian male.
you guys are just doomed. because you’re little sissies and you all know it.
and all irony aside i rather be a black man than a chinese person any day, anywhere in any dimension a billion times over.
Yes it’s okay for you to live your life in the shadow of others, always claiming you’ve had 5000 years of cultural shit…we’re han ethnics..you can have all that.
but at the end of the day your real contribution to the world is just bunch of yellow useless babies, fake dangerous products and bad habits.
Reply
-3J says:
Saturday, September 5, 2009 at 10:14 am
Once again the “nigger” appears before all of us showing us what they’re truly like. Instead of replying by facts, you throw a barrage of useless opinions that smell of penis envy.
Thank you very much for proving my point. And if you knew how to read, the post was Asians, not Chinese.
I’m gonna quote the master here again.
“There are blacks and there are niggers. The niggers have got to go.” – Chris Rock
Reply
Carlos says:
Friday, October 23, 2009 at 6:26 am
Loser!
Reply
-2Gaad! says:
Saturday, September 5, 2009 at 12:28 am
NO,NO, NO! He’s just an Uncle Tom of a brotha who’s been brainwashed by some racist whities to think like them.
He’s just desperate to join their Country Club that’s all.
Reply
The John says:
Saturday, September 5, 2009 at 12:28 pm
I like the clear humor of this post. It’s like all of your inner racist has come out. If someone told me blacks are better than chinese. I would call them an idiot. Mainly, race does not exist. There are black people in every country. Secondly, chinese is a Nationality. Not a race. So, it’s like one guy makes some gross generaliztions and you all join. To be honest, im ashamed of everyone today. Also, its easier to make gross generalizations about a lot of things. Don’t fight stupidity with stupidity. It’s… uhh.. Stupid. That’s like someone running into a wall and they you try to do it harder, just to show superiority. ALso, if someone says your “race” is “inferior.” Then you justify there idiocy, by repeating the same thing back at them….
Reply
Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 8:42 am
Damn you westerners and your “logic” !!
If the CCP says 2 + 2 = 5 then it MUST BE TRUE!
My TV AND my parents tell me that CHINA IS THE BEST AND WE ARE ALWAYS RIGHT! I LOVE MY COUNTRY!!!!
Reply
+1gongbaojiding says:
Friday, September 4, 2009 at 12:29 pm
Her voice sux, completely off-note. But she’s darn hot!
Above is an example of typical comment you should make. It has nothing to do with skin color, who her parents are, what they did whatsoever. It’s disgusting to think how narrow people are when it comes to physical adversity.
Reply
+1Blah says:
Friday, September 4, 2009 at 12:59 pm
Wow who knew that the Chinese were just like the Japanese, you ancestors would truly be ashamed, you’ve become the hateful creatures…
Reply
+4Felix Wang says:
Friday, September 4, 2009 at 1:58 pm
I come from China, I come from Shanghai, China. It is the first time I come here.
This website is extremely stupid. It only find some comments which are not so good. But does not translate positive comments and hortative comments to that girl. Actual most of people around me like this black girl. We encourage her and hopes her could go more far in that show. For most of Chinese people, we only balmed the black girl’s mother. Her activity is unloyal to her Chinese husband, it is not acceptable for a married women to have sex relationship with another man in China, not because he is a balck man or not.
Here for some people who blame Chinese only according to this stupid website’s unilateral translation. I feel sad for you all, you are so naive to belive this stupid website’s news, maybe it is the only way for you to contact China. The view of you is limited, but I am not. At last, China will become more and more powerful in the future. We will come back to the top of the world just like 200 years ago. Let’s go and see !
At last, I find most of the news in this website are unilateral, I do not what does these stupid website editor want. Do you get the money from anti-China fund? What can you hatemonger get?
For the intellectual people, I hope you can communicate with some guys who have been in China, you can know a more real China from them.
Reply
-3blurgh says:
Friday, September 4, 2009 at 2:10 pm
Hi Felix,
Great post,this is the best post i’ve read so far on this stupid/racist/lowlife website.
we need people like you.
seriously how can people be so hateful to each other?
Nothing good can come out of this, Nothing.
as humans we better learn to get along because whether we like or not we’re getting closer and closer.
there are actually more chinese living in Africa than Africans living in China.
Instead of promoting harmoney all this website does is sow seeds of evil in people’s heart.
THIS WEBSITE SHOULD BE SHUT DOWN.period.
Reply
pug says:
Saturday, September 5, 2009 at 12:43 am
Don’t worry Felix, as an educated and successful person who’s lived in China for three years, communicated with countless Chinese in their own language, and who has been earnestly praised for ‘understanding China very well’ more times than i care to mention, I do my absolute upmost to communicate the real China to those who haven’t been here before.
I ensure that the majority of Westerners I meet who have a generally positive view of China as a mystical, exciting, booming place with a great future in absolutely zero doubt that its people are the most soulless, brainwashed and DULL people on the face of the earth outwith North Korea, their minds permanently on standby, obsessed with being ‘top of the world’.
Oh, by the way, I’ve particularly enjoyed the fact that the majority of your Taiwanese ‘compatriots’ who I’ve talked to are in utter agreement about this. ‘Brainwashed’, ‘pitiful’ and ‘ignorant’ were all words that I heard used to describe the mindset of the PRC’s inhabitants within 24 hours of arriving in the ROC.
Reply
-4hellofriends says:
Saturday, September 5, 2009 at 1:41 am
Trash gravitates to white subhumans. For some reason all of the people I met in China were good people.
Then again, as a race of dogfucking illiterate retarded cavemen whites will attract the same in China.
They might be .1% of the population, but that’s still enough to keep the average baigui busy.
Reply
Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 8:39 am
Hellofriends is SEXY!
I want to have a gay threesome with you and Gaad!
We can jerk each other off while we sing patriotic songs about how much we love CHINA while stupid laowai men have sex with our Chinese women!
JIA YOU!!!
Reply
pimp_war says:
Saturday, September 5, 2009 at 2:02 am
Isn’t the ROC/TW not brainwashed only because it’s a puppet of the US?
Reply
-1eric says:
Saturday, September 5, 2009 at 12:12 pm
fact her father is black is telling though. China has how many blacks versus native chinese men?
she like most of those shanghai women are chasing after westerner men idol worship. apparently her mother found a black american male, in true chinese female angst since, spite her chinese husband by sleeping with a foreginer and someone who is black
BTW
I am living in USA, and I must say blacks are not exactly racist free here.
You have numerous crimes committed by american blacks against chinese students going to school USA
YOu can google and read about this in web
fact is Asians are still categorized and stereotyped by western media
http://www.amazon.com/Driven-Out-Forgotten-against-Americans/dp/0520256948/ref=sr_1_1?ie=UTF8&s=books&qid=1251958978&sr=8-1
the beginning of racism towards Chinese in early USA
Reply
+3HakNam says:
Friday, September 4, 2009 at 2:15 pm
fuck, you people really think you can gauge the average mentality or perception of an entire nation’s views on black people by a couple of postings on bbs forums? a nation where the majority are still rural and don’t have internet access? as a black man, i can attest to ignorance displayed by some uneducated locals or even first generation middle class students. however, it is more ignorance rather than hatred that i’ve felt and that is nothing compared to what i’ve dealt with growing up in boston where you could get your head smashed in just for wandering into the wrong irish section. all these self righteous white people posting in defense of this poor girl, i doubt are truly anti racism or are even angered by the issue. i bet its just another excuse to post racist comments against asians. a lot of you came to china and finally had a very small taste of what its like to be a minority and you’re angered that you’re not treated like the kings you should be or so shell shocked by the little racism that you personally experienced that you lose it and try to cleanse your white guilt (those of you from amerika) by getting into issues like this. look, hate all the chinese you want, just don’t do it under the guise that you are great defenders of us poor negroes. some of you little dickless thin skinned white boys are getting a small taste of what us blacks call “home” or at least the homes you have left for us.
Reply
BOS Neal says:
Friday, September 4, 2009 at 2:52 pm
Black is fine to any Chinese. The complex raise more curiosity than other emotions here in China. Adultery is NOT fine. Presenting obvious Adutery with foreign for fame is NOT fine.
We are not racist, we are just not as used to adultery as to some people above.
Reply
Felix Wang says:
Friday, September 4, 2009 at 8:40 pm
Great!
All the people could blame others racial discrimination, except USA. Look back to your bloody history!!!
Reply
rayfish says:
Sunday, September 6, 2009 at 8:19 pm
I’m a northern Irish catolic. i cud say wee know a wee bit about discrimination. friends murdered houses and shops firebombed year on year anti-catholic marches supported by the RUC and british army. systamatic discrimination from the top down. but im white so im responsible for slavery and so on.
when i lived in a black neighbourhood, they recognised this immediately and they tried to rob and beat me, sell me fake drugs evry single minute of the day.
i learnt fullwell that it was my fault for being white …..
the world works in a funny way
not haha funny but just plain crap funny. such is life
Reply
-2BOS Neal says:
Friday, September 4, 2009 at 2:19 pm
This is a typical cross-culture situation.
First of all, we have yellow people here. White or black is “laowai”, not our people. A black Chinese is already a shock in conventional Chinese culture, and adultery makes people feeling more…sick. If you wenstern people can not understand that, try to imagine a half-dog-half-human thing as your new neigbhour. No, I do not think the black are any better or worse than yellow, white, pink or purple. Yes, she is a freaking “thing”!
Western: Why these people can not accept yellow-blakc people, they are sick, they areracist!
Chinese: Why these people are not shocked, do they still have ANY moral standard at all? Are they still CIVILIZED HUMAN?!
There is no universal “right” thing. Equality, no-racism, democracy, freedom, lot of sex…these are all western. Surprice? We Chinese like them, just as we like beef and bread. But we eat pork and rice for dinner. Human do not share the same system of right and wrong. Never. Your system or our system of value/right-and-wrong is not better than that in a dog’s society, nor worse. Just different. Judging Chinese from western point of view is just as narrow minded as the extreme racists.
Reply
+1jay says:
Friday, September 4, 2009 at 2:43 pm
Most of the disparaging comments about the mother say she’s a bitch because she had an extramarital affair with a black man…. not just because she had an extramarital affair. This is racist crap.
Lou Jing, jia you!
Reply
+1jay says:
Friday, September 4, 2009 at 2:48 pm
BOS Neal,
You are a sub-human idiot. Not because of your race or the circumstances that you were born in, but because you are a racist prick walking abortion. For the sake of decent humans, please go drown yourself.
Reply
-1BOS Neal says:
Friday, September 4, 2009 at 3:45 pm
Good comment, very highly civilized person you are.
Did I mention anything about abortion?
Even in Un-decent Chinese culure, tell people to drown themselves is not so decent. Your “decency” does not even exist in other moral worlds. Is it too hard to understand that?
Reply
-3David Zhou (Felix Wang?) says:
Friday, September 4, 2009 at 8:51 pm
To the editor of this stupid website, if you want to instigate the hate between Chinese and Westerns. As a Chinese who previous had a good relationship with my wenstern colleague, I say you do a good job!
Some stupid wenstern idiot’s comments extremely change my good memory for foreigners! I need to think again what is my foreign colleague’s real mind even they express a freidly look to me everyday in Shanghai.
Reply
+3Mike Fish says:
Friday, September 4, 2009 at 10:48 pm
If you will let the nonsense spewed by idiots on the internet let you change your mind about people you know and never had a problem with before, you sir, must be a complete moron. Good luck in life!
Reply
+3pimp_war says:
Saturday, September 5, 2009 at 2:07 am
Get off the internet and get back to reality. Go find a latino expat chick and ask her out on a date or something. Make some Filipinos for China.
Reply
-1AmericanPachyderm says:
Saturday, September 5, 2009 at 4:14 am
I love it how Chinese people speak about China as it’s some kind of living entity on its own. China said, China feels, China thinks, China wish, China…
Herd mentality, One World, One Dream.
Go fuck yourself and rot in hell, CHINA.
H1N1+H1N5 will take care of that, thanks to the brilliant western biologists of this world.
Reply
-1BOS Neal says:
Saturday, September 5, 2009 at 7:53 am
Yeah yellow people die of flue and white people never. Yeah western governments have a stronger control so flue does not spread. Hahaha!
Reply
-1mike says:
Saturday, September 5, 2009 at 4:07 am
I like it as this, it shows to the Chinese people that foreigner are bunch of haters too base on limited views, so in the future I hope china will not treat nicely to these 老外鬼s.
Reply
yah says:
Monday, November 2, 2009 at 8:00 am
oh for gods sake, everyone’s an individual and everyone has their own opinions. Just because one person said something, doesn’t mean your “western” friend shares that same opinion.
Reply
blahblahblah says:
Friday, September 4, 2009 at 11:41 pm
Haha David Zhou. They hate you. Most likely think some weird shit about you and believe you should die.
Reply
blahblahblah says:
Friday, September 4, 2009 at 11:43 pm
Like I said before, westerners all really despite the Chinese. We’re like the most hated.
Reply
-2WhatAJoke says:
Friday, September 4, 2009 at 11:45 pm
hahaha, so many fat white losers being so desperately want to bash China at any chance they get, I have not noticed any racism in the OP’s link, but I have found a lot of “racism” here by the pathetic losers, how ironic.
The mother need to be sentence to life in imprisonment and this half-breed should sent to the US if you jokers really love her so much.
Reply
AmericanPachyderm says:
Saturday, September 5, 2009 at 3:04 am
If you’d give me the choice, I’d prefer to be a fat loser in a depraved nation like the U.S to being a Chimatron living in Retard Land.
Here’s why we don’t like your “nation”, nicely put in a childish fashion to make you understand better.
http://www.youtube.com/watch?v=8z1buym2xUM
In most people’s mind around the world, China ranks right below Iran and the other shit nations of this world.
1.3 billion people trapped in I (L) Sucky Land.
You can say whatever you want, in the end you are the one spoiling your ONLY life in a wasteland.
Not us, “evil multicultural globalist westerners”.
So, it’s not like we really care.
Don’t forget to drink hot water, to cure your terminal stupidity and narrow-mindedness.
Reply
-1BOS Neal says:
Saturday, September 5, 2009 at 8:03 am
You enjoy your youtube and live your fat loser life. Oops, youtube was founded by Chinese. Damn.
Reply
Fike2308 says:
Sunday, September 6, 2009 at 10:49 am
I wish I could enjoy youtube here in China but it’s blocked.
Reply
Gaad! says:
Sunday, September 6, 2009 at 11:39 pm
Well den use da Force Fike!
Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 8:34 am
I have a better idea Gaad!
Ignore that stupid laowai and play with the 2-inch LIGHTSABER in my pants!
The force is with me baby!
Link (baby fart mcgee zack) says:
Saturday, September 5, 2009 at 8:30 am
can u be 100% sure that your mom never cheated on your dad or your dad never fucked another woman? i guess they should all be sentenced to death,
you stupid moron
Reply
-2SF (Den/Gram?) says:
Saturday, September 5, 2009 at 10:41 am
I realize it may be impossible for a black to fathom, but yes, actually I am 100%, beyond the slightest doubt, sure that my parents never cheated on each other. NEVER. Since blacks don’t have anything bred into them except to have sex with as many as possible and run like cowardly shit, they cannot understand this concept, but I assure you it is very prevalent in the world, or at least with families that aren’t dysfunctional trash like this cheating cunt and the walking stain on Chinese society that she shit out.
Reply
-1VeerLeft says:
Monday, September 14, 2009 at 7:25 am
Two plausible responses. Pick the one that fits you.
1)You are an IDIOT. My parents never cheated on each other either… neither did plenty of my relatives and friends. So there goes your ridiculous KKK theory.
OR
2) You are an IDIOT. How could you know if they EVER cheated?Hmmmm… life is hard in a trailer park.
Reply
Valen says:
Friday, October 30, 2009 at 2:46 pm
Clearly your marriage is going to be infidelity-free. Good luck with your Middle Age mentality. Ha! I hope this conversation comes back to bite you IN THE ASS when you find yourself cuckolded (look it up), probably on your anniversary.
Reply
+1mimi says:
Saturday, September 5, 2009 at 12:08 am
AFRICA, AFRICA, AFRICA so it is a sample of showing bad image people in the world, for all chinese people who think africa are wrong people most of them are ignorant toward african, also the matter of black-american to be signified as black african it was loong time things it’s out of fashion now they are american and we are african and iam an african living in china see that i have alot good chinese people, not like those racist maniac, you want to know african are what kind of people? you want to know how they treat chinese in africa? go and see you chinese people atleast you should know that those american people,europen people you they don’t give a damn thing about you they think your a crackers, but atleast african people gives you respect stop insulting african people stop calling them black devils open your eyes white people and those black american they don’t give a shit about you, let the girl alone and her mom ,stop thinkin that your the right being in this world,
Reply
+1blahblahblah says:
Saturday, September 5, 2009 at 1:10 am
No I don’t mean to say we’re the most hated. Of course, I think we really have nothing on African-Americans being discriminated on, and the history of slavery. Slavery is just plain fucked, if you recall all the fucked up shit people had to endure. So people just fight the bullshit system. Just tear it down. Utterly destroy everything! Cleanse the earth!
I really hate the world and everything in it.
I really just wanna the Chinese racists to realize that every time you hate you are at the same time having the EXACT same hate being applied to you. So just don’t do it. Hate is not cool. It destroys one’s insides. You don’t wanna be like me ha!
When you are judging someone someone else is judging you!
Reply
karen says:
Saturday, September 5, 2009 at 1:53 am
wow, so much hate reaction.
my first thought after this article was- golly, she sings worse than me. and im pretty darn bad.
good thing she’s attractive, got the whole ‘exotic look’ thing going. i like it.
Reply
pimp_war says:
Saturday, September 5, 2009 at 2:12 am
I agree. She can’t sing for squat. I’m hoping she can at least dance.
Reply
+6Obi says:
Saturday, September 5, 2009 at 6:04 am
Racism goes both ways. I’m Nigerian living in the UK and I took my Chinese girlfriend to Nigeria for holidays and told my parents I wanted to marry her. They said I might as well have married a dog. They were having none of it.
Reply
+4Fike2308 says:
Sunday, September 6, 2009 at 10:26 am
Well, then use the force Obi!
Reply
+5Edmund says:
Saturday, September 5, 2009 at 6:52 am
Those comments are selective; they are balanced to show that some Chinese are not that bad on racial issues. You still have to see the most vicious comments. But it is not that Chinese are intolerant, for thousands of years they never saw a single black man, and for thousands of years, white skin (not pale or pink skin) represents the ultimate beauty, purity, morality, and even wisdom. It needs time for an Old culture to change.
Reply
+6weishemo says:
Saturday, September 5, 2009 at 7:55 am
What’s the problem here? Why all the hate? I’m Chinese and I think she’s pretty damn hot. People who crowd together on Han minzu forums are almost as bad as stormfronters, except there’s way more of you guys. Remember, almost all Chinese today are of mixed descendance, we just all share the same Chinese identity, which is the most important thing in the end.
Reply
-1BOS Neal says:
Saturday, September 5, 2009 at 8:06 am
If you do not care about “your” descendance being a,what everthing, and who’s not really YOUR descendance, tell your wife or husband about that. There are many to help here.
Reply
weishemo says:
Saturday, September 5, 2009 at 8:16 am
..what? try some grammar
Also, 400 GET
Reply
+2Fike2308 says:
Sunday, September 6, 2009 at 10:46 am
“If you do not care about “your” descendance being a,what everthing, and who’s not really YOUR descendance, tell your wife or husband about that. There are many to help here.” – BOS Neal
Can someone translate this into English?
Reply
-2J says:
Saturday, September 5, 2009 at 10:49 am
baby fart mcgee zack says:
“well i guess if stupids people have to be eliminated from the face of the earth…there won’t be one chinese left standing.
we all know that chinese are the single,stupidest people on earth.”
Yes . . . the stupidest people on Earth should be eliminated.
But wouldn’t that involve the entire continent of Africa where people RARELY go to college and the vast majority are so fuckin’ stupid that they keep on killing each other and keep on begging the world for more help and support?
Oh and of course we MUST respect these pirates, rapists, terrorists, murderers, pedophiles, thugs, etc. at the same time, even though we’re piting them.
I ABSOLUTELY agree . . . the STUPIDEST people SHOULD BE ELIMINATED . . .
You truly are a moron.
Reply
+1mimi says:
Sunday, September 6, 2009 at 3:09 am
I think your less educated than those African brother china is country full of rape , robbery , drugg shit,terrorist are asian (arab most) and not african what happening in africa is called civil war not terror brother more than africa itself but the truth is your lead by people who don’t want you to see those, don’t want afool to be open atleast african peopl fight for the democracy, atleast you share the blood of those innocent African for making your country grow up ,if you not a moron then why you you can’t open your mouth a point a finger to your leaders and tell them they share blood of African just to make your belly full, you don know a damn thing about the issue of Africa so shut up brother,too many wars in asian happen and happening too ,indonesia too many killing of chinese han,in cambodia is fuckin non stop, in sri lanka over 30 years of war (are those african countries educated j?)non of problem from africa was caused by african but stupid white ancestors and ignorant african kings of that time so we both share what in there
go get educated ,
Reply
+1Fike2308 says:
Sunday, September 6, 2009 at 10:42 am
Go get educated where?
Reply
J says:
Sunday, September 6, 2009 at 9:55 pm
Yes indeed. GO GET EDUCATED. LOL!!!
Thank you very much. You made my night. Even without your grammar mistakes, your logic, reason, history, facts stink of urine that only you are capable of.
You don’t even understand the meaning of the word, “terrorist”. It’s not associated with only Muslims. It can be associated with any individual.
The rest of your post isn’t even worth my time answering to. But you truly are a great example to my previous post. THANK YOU for proving my point.
Reply
-3FindFauna says:
Saturday, September 5, 2009 at 10:54 am
Nice job to the person who runs this garbage site, stirring up hatred for a few extra clicks. Who is this “fauna” scum? That should be the real target for the human search engines. Should be killed…this kind of pointless selfish garbage does only damage to a large number of people and to society itself, and only “benefits” one selfish scum. What more definition is there of someone’s selfishness deserving death. Should really be killed.
Reply
-1Tianchaodaguo says:
Saturday, September 5, 2009 at 11:42 am
u mad?
your posting under dif names pretending to be dif people is pretty obvious
you think your racist words speak for chinese people? you’re a disgrace and a bigot.
Reply
+1Fike2308 says:
Sunday, September 6, 2009 at 10:44 am
Someone doesn’t like free speech….
Reply
+1blahblahblah says:
Saturday, September 5, 2009 at 1:03 pm
POST #421 BITCHES!
Reply
+1blahblahblah says:
Saturday, September 5, 2009 at 1:14 pm
just shutup guys. These posts are getting seriously hateful.
Reply
-8fred says:
Saturday, September 5, 2009 at 2:11 pm
Wow! It’s now over 400 hits!
Who are the Chinese pimps that run this forum?
Where is that load-mouth, opinionated, windbag, Kai?
He pollutes silly, asinine topics with his pseudo intellectualism yet, a topic, Chinese racism – that cuts to the quick Chinese character, integrity, decency, and even humanity – the clown says nothing. He should, at least, have several 10,000 word essays, for a topic this hot.
At least Ming, who (pays-1000-rmb-to-get-his-balls-licked) made a feeble attempt to protect Chinese honor.
For you clowns that run this forum: if you’re going to present tabloid topics that show Chinese and China in very bad light, at least provide some intelligent arguments to counter the racists, idiots, and Sino-phobes this topic attracts, otherwise, close this topic.
Reply
+6Kai says:
Saturday, September 5, 2009 at 8:55 pm
fred (presuming you’re the fred from previous threads),
Where is that load-mouth, opinionated, windbag, Kai?
He pollutes silly, asinine topics with his pseudo intellectualism yet, a topic, Chinese racism – that cuts to the quick Chinese character, integrity, decency, and even humanity
THIS is precisely why I’m not in this discussion, because I could see how quickly this thread would degenerate into racist idiots self-righteously criticizing each other’s racism.
How IRONIC that you beg chinaSMACK to “provide some intelligent arguments to counter the racists, idiots, and Sino-phobes this topic attracts” yet you waltz into this topic by suggesting that this topic about Chinese racism “cuts to the quick” of “Chinese character, integrity, decency, and humanity.” Humanity! Wow, fred, is that the sort argument that qualifies as “intelligent” with you?
Fred, if you would have paid attention to what I actually stand for instead of what you project onto me…if you would have paid attention to what I’ve actually written instead of what you want to put in my mouth, you’d already know that I absolutely detest and denounce the racism here as I would do so anywhere else. Some of the racism I can understand as being born out of ignorance, but I don’t accept it, excuse it, or justify it. For the racism born out of genuine hatred and malice, nothing further needs to be said.
Between you and I, however, the difference is that I don’t see racism as uniquely a Chinese problem and I don’t feel compelled to hold up instances of racism by some Chinese people as representative or suggestive of Chinese character as a whole. I don’t suggest it says anything about their overall integrity, decency, or humanity. Why? Because that is the same fucking thing these racist assholes are doing, Chinese or otherwise, to blacks or whites or whatever. You are thinking exactly like they are, just with a different target and victim in mind.
I have openly said that some of the most racist people I know are in China and are Chinese. The difference between you and I is that I don’t feel some immature and insecure need to elevate the sins of some people to the sins of an entire people. I don’t feel the need to argue that seeing the ignorance and malice of the few is seeing the ignorance and malice somehow inherent and one with the very character, integrity, decency, and humanity of all or any “Chinese” people.
I don’t think your idiocy represents the character, integrity, decency, or humanity of your country or your country’s people. I won’t ignore, excuse, pardon, or justify the racism of some Chinese people, but I won’t jump ahead of myself and think, much less openly argue, that racism is part of their character, integrity, decency, or humanity…as you have.
Go ahead and make fun of how much I write, or how opinionated I am (simply because I have a different one than you), but guess what? None of it changes the basic fact that you’re a racist prick. Congratulations.
Reply
The John says:
Saturday, September 5, 2009 at 9:20 pm
Kai for President! or is that Chairman?
Well, said sir… and well played…
To you, I offer a toast.
Actually, I was wondering why you didn’t offer a comment in this post. Suddenly, I realized why. The comments on this post brought out multicultral racism, by the likes of which I have never seen. Now im wondering why I commented. Still, some rational voices are better than nothing at all.
Reply
-2Antwerpren says:
Saturday, September 26, 2009 at 2:56 pm
I have openly said that some of the most racist people I know are in China and are Chinese.
Kai, you’re such a liar. You’ve gone through great lengths to defend your theory that the majority of Chinese are “innocent racists” because they have limited experience with other races. Are you now abandoning that position? You have zero credibility.
Reply
+2Kai says:
Saturday, September 26, 2009 at 4:02 pm
Antwerpen,
I don’t see how I’m a liar or how I’m abandoning my position when I’m pretty certain I’ve always “openly said that some of the most racist people I know are in China and are Chinese” in China. Note that such a statement is not mutually exclusive with my belief that the majority of Chinese are racist due to ignorance (limited experience/exposure to other races) and not genuine malice. I welcome you to go back and find my comments, quote them, link to them, and I’m pretty sure it’ll evidence the consistency of my position.
Reply
-2Antwerpren says:
Saturday, September 26, 2009 at 7:45 pm
I knew you’d have it both ways. You always do.
Rest easy, everyone. All things reconcile within the mind of Kai.
Alan says:
Saturday, September 5, 2009 at 4:16 pm
Ehhh…you do know that the Han and many other non-muslim ethnic Chinese minorities love their porkies and their booze right?
Sure, that’s because they are not muslims right? Hence they do as they please as they are not bound by the strictures of Islam.
Besides, how do you know that the Uighurs are particularly keen to share with the Han students. Racism and prejudices cut both ways.
Perhaps it does. But official government policy is to deny uyghurs government jobs, bar them from some hotels, forcing them only to open restaurants or take to crime. Don’t believe everything the media or propaganda machine says….
Reply
Gaad! says:
Saturday, September 5, 2009 at 8:32 pm
“Sure, that’s because they are not muslims right? Hence they do as they please as they are not bound by the strictures of Islam.”
We shall hence forth all bow before da might of Allah and the words of Mooo-hamed (must not forgit Alan’s words too) for his words are the words of GOD! (tis true I tell’ya it says so in da book so it must be true… wait’a minute, da Bible (take ye choice of editions and/or denominations) and da Tora also says dey book are the words of GOD! too. Well bugger me! Wat do u know!
Chinaman:
“Huh, Koran? Bible? Tora? Who cares? Me don’t care and me don’t want want to know. Now go away, shoo.”
“Don’t believe everything the media or propaganda machine says….”
Right back at’cha kiddo. Mehhhh!
Reply
Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 8:20 am
That’s right Gaad!
Organized religions are stupid!
Now, let’s meet up and share our favorite passages from Mao’s little red book and then we can burn down some buddhist temples together!
I LOVE CHINA!!!!!!!!
Reply
+3Sha says:
Sunday, September 6, 2009 at 5:49 am
Most of you are ridiculous. Most of you do not know anything about black people.
Black people are just as varied with different skin tones and looks. I think all of you should stop watching American tv and actually go to England or America or Canada and see what real black people look like.
Also asian and black mixed babies come out in different skin tones, sometimes very yellow sometimes darker.
Also bet you didn’t know that Slash(guitar player for Velvet Revolver, Guns and Roses), and Lenny Kravitz are mixed with black and white(I know not asian).
Also Africans are very different from black Americans. Black Americans, some have had centuries of mixing in the blood line and Africans themselves make the distinction between themselves and black Americans.
Also check your history. In the 1800’s in America, there were many many marriages between blacks and Chinese!
I have seen many very attractive asian and black mixed people with light to dark skin tone. (Japanese, Chinese, Korean, Vietnamese, etc.)
For those of you who this applies, get off the white horse and also realize the world is mixing it up more than ever now a days.
Reply
Alan says:
Sunday, September 6, 2009 at 8:09 am
“Huh, Koran? Bible? Tora? Who cares? Me don’t care and me don’t want want to know. Now go away, shoo.”
A whole heap of difference between an organized religion/s that have thousands of years of history and worshippers all over the world, and some godless awful ideology that has done nothing but rape land, brainwash people, and make certain countries, both in terms of education and environment, light years behind others.
Reply
Gaad! says:
Sunday, September 6, 2009 at 10:21 am
“A whole heap of difference between an organized religion/s that have thousands of years of history and worshippers all over the world…”
One, two, one, two, three! All together now!
Kumbaya, my Lord, kumbaya
Kumbaya, the Lord, kumbaya
Kumbaya, my Lord, kumbaya
O Lord, kumbayaaaaahhh!
Someone’s laughing, Lord, kumbaya
Someone’s laughing, Lord, kumbaya
Someone’s laughing, Lord, kumbaya
O Lord, kumbayaaaaahhh!
Someone’s crying, Lord, kumbaya
Someone’s crying, Lord, kumbaya
Someone’s crying, Lord, kumbaya
O Lord, kumbayaaaaaahhhh!
Someone’s praying, Lord, kumbaya
Someone’s praying, Lord, kumbaya
Someone’s praying, Lord, kumbaya
O Lord, kumbayaaaaahhhh!
Someone’s singing, Lord, kumbaya
Someone’s singing, Lord, kumbaya
Someone’s singing, Lord, kumbaya
O Lord, kumbayaaaaaaaahhhhhh!…….
Arrrggghhhh! Onward Christian soldiers! Dey godless heathens must DIEEEE! Dey Christ-killing Jews must DIEEEE! Haaallelujaaa!
Insha’Allaaaaah! Dey kafirs must DIEEEEE! Fer da virgins, da viiiirgiiins! Allaaahuuu Akbaaaar!
Da Jew: Ignore da goyim, just ignore dem, then maybe dey go away….uggghhh! Oy vay! Too late! O Yawhweh, dey killed me and I circumcised meself for you… da contract, remember da contract….
Da Chinaman: Huh?! Fight over Books? Vee haff printing and vee haff many, many books! Why Fight? Dey all crazy…
PS Communism in many instances was actually a disguised nationalist movement in reaction to colonialism, colonial capitalism/mercantilism and undue western influences. You really need to give your Cold War Bible hump…sorry thumping a rest and consider alternative interpretations. Or in the eternal words of a sagacious one on this thread here once said: PICK UP A BOOK (other than the Bible) ONCE IN A WHILE!
Reply
Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 8:24 am
Good job Gaad!
The only book us Chinaboys need is Mao’s little red book!
Reply
+4dave says:
Sunday, September 6, 2009 at 8:09 am
I’ll bet she has beautiful nipples.
Reply
Fike2308 says:
Sunday, September 6, 2009 at 10:40 am
The very fact that this event/post/article is such a big deal in China says a lot about China.
Reply
Gaad! says:
Sunday, September 6, 2009 at 11:22 am
Is it? OH No! It’s da end of China!
Reply
+1Jaime de la Esperanza says:
Sunday, September 6, 2009 at 10:58 am
I doubt that adultery is limited to black men or foreigners. Every town I’ve been to – from tiny Meizhou Island, Fujian to Kaifeng, Nanjing, Jinan, Xiamen, etc – has had tons of brothels. Are any of the people who justify the hatred for this girl willing to suggest that they only allow single men into these brothels? Or that all the married men who visit them have signed and notarized permission from their wives to visit?
As for those of you saying all blacks are lazy drug dealers, I doubt any of you have attended a Chinese university. I studied at Donghua and had friends at Shandong Uni and Jiaotong, and all of us (black) were and are productive wherever we went.
As for blacks in the U.S., I suggest you study up on the Civil Rights Movement. It was in direct result of the Civil Rights Movement that laws against foreign immigration were repealed (I believe 1965) and Asian immigration to the U.S. began picking up steam again. In fact, a lot of the “civil rights” that we now take for granted, and most of the protest movements – anti-war, women’s rights, Stonewall, etc – were based on the Civil Rights movement, started and sustained by such people as Rosa Parks, Thurgood Marshall, M.L. King…
I just get tired when I constantly hear Chinese on one hand complain about how racist each and every single criticism of anything Chinese is, yet they show a startling lack of empathy for blacks. Witness the comments towards Condeleeza Rice when she visited the region during her reign of banal terror.
What is funny is that nearly all of my black friends and relatives are really interested in China, in fact many of them who don’t know much at all about modern-day China remember our school lessons about the problems Chinese experienced while building the railroads in California, and feel a sense of admiration for what China has done in recent years.
Every dog needs a dog of it’s own, I guess.
So lets see if I can sum up many of the comments I’ve read and heard: Chinese cannot be racist, but if they are, blacks deserve it, cuz we are dogs anyway. Adultery and abandoning infants by this miserable black man is wrong, but we shouldn’t consider the thousands and thousands of 100% Han Chinese babies that have ended up at orphanages (and many overseas) over the past few decades. Plus, even though this girl’s mom stated that the man DIDN”T KNOW she was pregnant when he left, this man is still a symbol of blah blah blah.
Funny bunch, the Chinese online community.
Reply
Gaad! says:
Sunday, September 6, 2009 at 11:58 am
“As for those of you saying all blacks are lazy drug dealers, I doubt any of you have attended a Chinese university. I studied at Donghua and had friends at Shandong Uni and Jiaotong, and all of us (black) were and are productive wherever we went.”
You did? Ahhh, den u cannot be a Nigerian den. (Sorry, I know it’s wrong, but I just couldn’t resist)
Welcome to ChinaSmack: The Human Zoo Where You Can All Gawk At Each Other And Feel Better About Yourself Afterwards. ALL For The Price of A Few Mouse Clicks.
Reply
Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 8:26 am
Gaad! I wish you would stop TROLLING all these stupid laowai and TROLL my hot, yellow asshole instead!
Come on baby! Let’s have gay butt-sex on a portrait of Mao Zedong!!!
Reply
+2Jaime de la Esperanza says:
Sunday, September 6, 2009 at 11:44 am
I am surprised no one has mentioned it yet, so I will: why does this girl’s beauty have to be her salvation? If she were fugly, wouldn’t she still have merit? I don’t care for the racism one bit, but to suggest that she should be spared because she is attractive is not really the path you want to follow. Well, I wouldn’t hope so, at least!
Kudos to those who mention that the comments on BBS are not (at least we hope) symbolic of Chinese society as a whole. Sometimes it’s easy to get caught up in the anonymity of the net, where you can be casually cruel as a means of X ( X = well-articulated social theory of human tendency towards meanness as a mode of release).
Well, it’s been about 14 years or so now, the internet has become really commonplace and it’s broken down barriers and been an amazing tool for communication. But… I’d say that the civil society we were all expecting will have to wait.
Imagine paying $49 a month to Comcast to have access to the world’s biggest bathroom wall. That seems to be the internet currently.
Does it reflect the real world?
Jaime de la Tristeza
Reply
+1D says:
Thursday, September 10, 2009 at 9:05 pm
“Ugh. Yellow people and black people mixed together is very gross…only black skin, not yellow skin, chocolate skin…”
I think people are mentioning Lou Jing’s beauty because of this comment. Clearly, this girl does not look ugly or gross, so whoever made this comment is either blind or full of ignorance-induced hatred. I think we know it’s the latter.
Reply
+1Alan says:
Sunday, September 6, 2009 at 4:43 pm
GAAD,Your anti religious sarcasm really is quite disgusting. And your comparison of communism with organized world religions just doesn’t wash. Nice cheap shot, below the belt though it is.
GAAD wrote:
You really need to give your Cold War Bible hump…sorry thumping a rest and consider alternative interpretations. Or in the eternal words of a sagacious one on this thread here once said: PICK UP A BOOK (other than the Bible) ONCE IN A WHILE
I’m intrigued by hot potato tossing like this, are you chinese?
FYI, I’m not a christian, I’m agnostic, perhaps you can PICK UP A BOOK ONCE IN A WHILE to figure out what that means instead of making FALSE ACCUSATIONS!!!
Reply
Gaad! says:
Monday, September 7, 2009 at 7:03 am
Huh?! Me comparing commuuu-ism wit organisierten religions? Hmmm, letsy me reminding u:
Exhibit A
Alan:
“A whole heap of difference between an organized religion/s that have thousands of years of history and worshippers all over the world, and some godless awful ideology that has done nothing but rape land, brainwash people, and make certain countries, both in terms of education and environment, light years behind others.”
Ahem, me thinksy Alan mistakes contempt for stupidity wit contempt for religions. Now da biggie question: Wat does dat makes Alan?
Wat u haaf against hot potatoes? Dey verily lecker wit fromage und coleslaw und things ja? Or makes it into potato fondants mit gravy…mmmm…yummy!
U tell me wat a Chinesey izz den maybe I tell u if I’m one or not. Ooor maybe I’m LEGION! Cackle! Cackle!
“FYI…I’m agnostic…”
Woooooo!Goody fer u fer knooowing exactement what u are! Wear da lable wit pride mon! Go Agno! Go Agno!
(Whisper: Either he can’t really make up his mind or he’s just scared that there really is a GOD! Poor dear…)
Reply
Joshua says:
Sunday, September 6, 2009 at 5:32 pm
Whoa! This girl is stunning! China is home to some of the most racist people I have ever met. I can’t believe what some people say about this girl. She is Chinese born and raised. Welcome to the future!
Reply
-1rayfish says:
Sunday, September 6, 2009 at 6:38 pm
r u ppl tripping? that chiggerboo looks ill.
i mean talk about a worst case scenario in action. wot a clusterfuck. a dirty, lying, (neva seen b4 lol) chink whore and a hit’n run jig’s spawn. no wonder it makes news
i suppose we shudnt call a child ugly as it wasnt her fault right?
Reply
tipsy2009 says:
Monday, September 14, 2009 at 1:15 am
Are speaking Chinese?Your writing is possibly from outerspace.Anyway, the guy is cute.
Reply
+2The Grudge says:
Sunday, September 6, 2009 at 11:28 pm
Hi everybody,
It is with great pleasure that I announce this thread, from the ChinaSmack website, as the winner of the Backward Racists Fucktards Award 2009.
We’d like to thank everybody that took the time to comment, and showed their true colors to the world.
We encourage you to support our cause by visiting our site and sending a donation:
http://www.inbredandproudofit.com
The Grudge
Reply
+1The Grudge says:
Sunday, September 6, 2009 at 11:51 pm
The human race will one day split into two separate species, an attractive, intelligent ruling elite and an underclass of dim-witted, ugly goblin-like creatures, according to a top scientist.
Men will have symmetrical facial features, deeper voices and bigger penises, according to Curry in a report commissioned for men’s satellite TV channel Bravo.
Women will all have glossy hair, smooth hairless skin, large eyes and pert breasts, according to Curry.
http://www.dailymail.co.uk/sciencetech/article-489653/Human-race-split-different-species.html
Kinda fucking pointless to argue about something as trivial as skin color, isn’t it?
And Chinese guys should be happy, as there is hope that one day in the distant future they will be equipped to please the ladies.
Reply
-1Gaad! says:
Monday, September 7, 2009 at 7:23 am
Wow!!! A Daily Mail reader who “knows” Chinese men’s genitalia.
Wonder never ceases!
Reply
Defend China against logic and reason! (Fike2308) says:
Wednesday, September 9, 2009 at 7:59 am
But, in my heart, I believe you are the true expert of Chinese men’s genitalia Gaad!
Don’t be so jealous of that stupid heterosexual foreigner!
We must not let these foreign men steal our gay Chinese men from us!!
Reply
-1Gaad! says:
Wednesday, September 9, 2009 at 8:43 am
Giggles! And you “know” I’m gay? LOL!
Now I remember! Ain’t you the one who reamed me arse down that dark alley the other night?
Came back for some more of that love of Gaad! is it?
LOL!
Reply
+2Gaaad!'s GAY lover (Fike2308) says:
Thursday, September 10, 2009 at 9:13 pm
WHAT??
Gaad, did you have sex with a man and not invite me again?!?!
+1Wanting Gaads Love says:
Monday, September 14, 2009 at 3:58 pm
Yeah dude, do it for China, if not for yourself. You’d get more medals than China did at the olympics. Come on dude, man up, your gay, step up to the plate dawg!!
Get yo’ freak on biatch! These guys all want it man!!
+1OT says:
Wednesday, September 30, 2009 at 10:17 am
China is still nothing but a large village. The economy and construction is forever growing . but the people are unfortunately doing all they can keep their heads buried in mud. All those writing the nasty stuffs about Lou Jing simply can’t stand her beauty. Ever since there was a crack of opening up by the Chinese to the outside world, there is no going back. the crack will keep widening till the village, literate but uneducated people of china are ste free from themselves.
Reply
AmericansPerception says:
Monday, September 7, 2009 at 12:31 am
Yawn….
The 500 million Chinese women of all classes, incomes, talents, backgrounds, ages, and statuses are being abducted by the special Asian clouds. Then these clouds are traveling to Africa. Finally, they stop there and start to drop all of those women. Worldwide news is reporting that the whole African continent is receiving the rain of Chinese women. “Raining Chinese Women” is being added to English-idiom dictionary, after the popular 19th-century idiom known as “Raining Cats and Dogs”.
Reply
Eizzy says:
Monday, September 7, 2009 at 9:17 pm
Ebony Black ….sweet pretty hot chocolate damn you sexy …all these noodles ass and frog face just hating cuz they wanna be like you …and that impossible for them …. hehehe, Mina for Miss China…. Go Girl, you rock
Reply
David says:
Tuesday, September 8, 2009 at 6:40 pm
I think this girl is hot, and it’s so wrong to be racist towards her. But damn… this girl can’t sing at all, she can’t be half black no way. I don’t think i’ve ever heard someone sing so bad. Good to look at though.
Reply
sukmuhdikmuhfugger says:
Wednesday, September 9, 2009 at 1:02 am
Once you go black, you won’t go back!
P.S: Spring Thomas and Obama’s mother both agree.
Reply
Pippo says:
Thursday, September 10, 2009 at 1:14 am
She’s beautiful and talented and will be a success anywhere she goes.
Reply
+2MD says:
Friday, September 11, 2009 at 6:25 pm
ITT: Trolls trolling trolls trolling trolls.
Gotta love the internet.
Reply
rambutanjuice says:
Saturday, September 12, 2009 at 5:27 am
the world never learnt its lessons…greed,power,lust,superiority,religion insults,genocide wars,racism breeds hatred….excercise more compassions and restraintments please people…let the sinless cast the first stone…but..i really think they used a black condom…thats why she endup this way hehehe.btw..she is beautiful…and i am chinese .
Reply
duke says:
Saturday, September 12, 2009 at 10:38 am
Chinese people ought to know that it was their animosity towards Black people that led to the Tianaman square masaccre and if not careful, that could happen again.You can look up: http://en.wikipedia.org/wiki/Nanjing_anti-African_protests
Reply
+3duke says:
Saturday, September 12, 2009 at 10:43 am
Chinese People ought not just pay lip service to so called “One World/One peolpe dream”
They ought to know that it was their animosity towards black people that culminated in the T Massacre.
It not careful, history could repeat itself. Please refere to http://en.wikipedia.org/wiki/Nanjing_anti-African_protests
Reply
+1Alan says:
Sunday, September 13, 2009 at 6:22 pm
They’ll never get it Duke. It was all just a CIA conspiracy, don’t you know?
Reply
+3BlackMan says:
Monday, September 14, 2009 at 6:13 am
You RACISTS, RACISTS, F***ING RACISTS!!! The only thing shameful is that Lou Jing’s mother had sex outside her marriage. There is nothing shameful that the other man was Black. Whether the other man was Black, White, or Chinese, is irrelevant! And there is nothing shameful that Lou Jing was born. And there is nothing shameful or “ugly” about Lou Jing’s beautiful brown skin.
Reply
+1Alan says:
Monday, September 14, 2009 at 7:49 am
The only thing shameful is that Lou Jing’s mother had sex outside her marriage.
And that’s not even shameful in the civilized world. What’s wrong with people having sex? Obviously in China the word can’t be mentioned, despite the huge sex industry INSIDE the country….
Reply
+1Ze1andOnly says:
Monday, September 14, 2009 at 7:37 pm
Wow! I came to china smack so I could learn a little more about what’s the buzz in this country I live in and am quite appalled. Not just at the Chinese responses but the responses here on chinasmack. I already knew the Chinese were awfully racist by the talk and actions that go on whenever I walk out the door. But, to see foreigners with such racist comments, attacking each other… this is a sad world!
As for Lou Jing… poor girl. She’s absolutely correct that she shouldn’t be judged by her parent’s mistakes. Judge her for who she is. She actually is a pretty girl and all those people saying otherwise are just attacking the skin color. This is just sad!
Reply
Theresa Doghor says:
Tuesday, September 15, 2009 at 1:05 am
She is a pretty girl, there is no reason why she should be moved by the railings of ignorant people.
If i was her, i would live my life to the best i can and be satisfied.
Reply
A silent Observer says:
Wednesday, September 16, 2009 at 10:11 am
I married a Chinese woman and I’m Black.
We f–k everyday.
Now she’s pregnant.
Another ni99er has taken another one of your women
Deal with it.
Be racist all you want. I will just keep f–king my Chinese wife and we will live happily ever after :)
Reply
+1banana ripper says:
Wednesday, September 16, 2009 at 11:10 am
the chinese need to educate themselves on matters regarding ethnicity and skin colour….this racist bullshit is truly pitiful.
Reply
Chen says:
Wednesday, September 16, 2009 at 1:06 pm
F–k you. What do you think your wife is? Though i don;t have any problem with blacks marrying chinese, the way you put your words is offensive.
So what if you are black? What if you call yourself a ni99er? The most important is you love your wife. By the way you put your words together, it gives me the impression that your wife is just another sex machine with no feeling.
Reply
jack says:
Friday, September 18, 2009 at 7:54 pm
how do you know ? maybe she is the one who fucks around
Reply
Carlos says:
Friday, October 23, 2009 at 6:08 am
It is good that you have a woman that you love and as a man of color that is indeed great news, but can you try to be a little bit more serious when engaging in a debate. We are Black, not N*****s! When responding and or making points, try to be more logical and less ghetto.
Reply
A silent Observer says:
Wednesday, September 16, 2009 at 4:27 pm
I guess Chen has never heard of sarcasm.
Reply
-2Asian love Black says:
Thursday, September 17, 2009 at 12:37 pm
Asian ppl are not racist, we hate every other races equally. But everyone is entitle to their opinion although openly judging a person is wrong, especially the comments are quite offensive.
But regardless aesthetically a black person does not attract me. There is a reason why there are different races, that is because we are attracted to others who share similarities to ourselves, ofcourse there are exception such as this case, if you ask me do i respect her choice, answer is yes, but would i want to be her friend, answer is no.
Reply
-2GGooDeiMC says:
Friday, September 18, 2009 at 2:24 am
See this is what I do not understand about racism.
Me being a black woman. You being a Chinese. He being a Mexican. And them being a Arab…we all considered NIGGERS in the eyes of a white person. I was born and raised in one of the few racist places in America. GEORGIA and I know first hand what racism is truly is. And for all of the Chinese/Asian people in China that are walking around talking about black this/mixed relations that.
Try coming to America and see what type of respect you will get when you are face to face with purdI racist white person. You will be called everything in the box from a CHINK to a YELLOW NIGGER.
It baffles me that you all from white to Asian were originated in Africa, but you continue to be racist. I have read texts that state within the Asian culture some of your fighting styles and religious aspects were taken from the African culture.
So stop with the bullshit. It is 2009 and if you are still on the Jim Crow/Willie Lynch bullshit. You are child…nothing but a CHILD! And I feel so sorry for you. Because if you not took the time to look around you. Interracial relationships are on the rise and within each race someone is trying to taste a different culture…wake up and stop being on STUPID MODE!
Reply
+1halo says:
Friday, September 18, 2009 at 6:24 am
You’re right sister. The Chinese are the product of African tribes moving eastward. We’re basically the same people!
Reply
BERT.Canada says:
Friday, September 18, 2009 at 9:07 am
Right On!!
We are in 2009, we are a diverse world.. racism should stop.
Reply
Rosebelle says:
Wednesday, September 30, 2009 at 12:13 am
I agree with you. People just simply don’t know how it feels like to be discriminated against unless they’ve experienced racism/discrimination themselves. In some parts of the U.S., as I learned from my high school teacher, there is no Chinese people so other ethnic groups, Whites, Blacks, or Hispanics, don’t even know how a Chinese person looks like. When my high school teacher moved to San Francisco, CA, he was just so in awe at all the Asians living here, to him, we do look different, of course no offense to that remark. It is hard to accept something that is so out of the norm of people’s lives. If you are not exposed to diversity, accepting people from walks of life is difficult.
Reply
El oh el says:
Tuesday, November 17, 2009 at 11:17 am
Yeah Whites and Asians came from Africa but you see the difference between them and you Blacks is that they evolved once they left. :)
Reply
ikan says:
Friday, September 18, 2009 at 7:42 am
dude! she’s beautiful!
racism is so stupid; really, there is no need for an explanation after that.
Reply
banana ripper says:
Friday, September 18, 2009 at 8:34 am
“Asian ppl are not racist, we hate every other races equally.”
so you are claiming that you are xenophobic ? or are you merely arrogant, weakheart 狗日的 ?
Your inability to confront and claim responsibility for your ignorance loses far more face in the long run.
Reply
BERT.Canada says:
Friday, September 18, 2009 at 9:04 am
All you people with the rude and racist comments should be ashamed.. She should not be blamed for her parents mistakes, she did not ask for this..
I am chinese but I was not taught to hate and be racist like what all of you are doing.
She is a human being too..
You should all shut the fuk up and mind your own business, go take care of your own miserable life and stop harping on others.
Lou Jing you are beautiful, forget about all these @ssholes on the internet that talk all tough…
Live your life happy!!
Canada Representing!!
Bert
Reply
jack says:
Friday, September 18, 2009 at 7:51 pm
“parents mistakes” ? who did the mistake ? the yellow or the black ? and why is mistake ?
Reply
Bert says:
Friday, September 18, 2009 at 8:11 pm
I meant parent, which is the mom.
The father is innocent, the mother shouldn’t have cheated while she was married. At least get a divorce first.
Reply
+1jack says:
Friday, September 18, 2009 at 9:25 am
why yellow people like to get fucked by white people ?, soon you will all be mixed with other color people….don’t worry there are sooo many yellow people in this planet.
i can’t believe that people think that was a mistake that her mom had a chilled with some one non chines…….you think yellow is the best ? HELLOOOOOOOOOOOO let people fuck and mix wake up yellow people !!!!!!!!!!!! let the sperm run in ur pussy yellow people stop fucking be so stupid yellow people but some color on ur skin yellow people
Reply
+4Atsushi says:
Sunday, September 20, 2009 at 1:04 pm
Wow!!!! How pitiful it is seeing so many chinese making themselves feel better than blacks by putting them down, so much. It is a consistent habit for those who have been pushed down to make themselves feel better by shitting on others. When we from Japan did awful things to Chinese, looks like it really messed up a lot of Chinese brains into having inferiority complexes. Now you talk so awfully about your own kind. No wonder you are the way you are. INFERIOR… and why in Japan we have learned to embrace foreigners and progress. My wife is from India and I’m so disgusted with the way Chinese treat her because of their complexes. Get a grip and advance your nation. Do not become facists like we were so many years ago. The behavior of the ignorant ones on this site are unacceptable!!!!
Reply
Friendly says:
Sunday, September 20, 2009 at 1:10 pm
yes, it seems the chinese like to talk shit about other people to make themselves feel better. very evident.
Reply
Shane Madgett says:
Monday, September 21, 2009 at 6:36 pm
I notice the racists on here will not reveal their real names.
You should do so. I would love to meet with you in public, and have you loudly proclaim your racism to the world.
this is sick, I hear local people wax poetic all day about a mixed baby, then when they see one, they make fun of her. this girl is beautiful.
making fun of extramarital affairs? i’m told by many locals that they commonly believe that love can not last past ten years, and that extramarital affairs are normal.
making fun of her mother for having an affair with a black man, have youlooked closely at your boyfriend of girlfriend? he/she is probably a pig standing on two legs.
live your own life, to each his own. but you can’t. your life is so boring you must get involved in others lives… isn’t there a cyclist who was hit by a bus outside that you can crowd around and watch? a foreigner you can treat like an escaped monkey that you can point to and tell your children to touch his nose?
leave her alone.
Reply
Jesse says:
Tuesday, September 22, 2009 at 11:00 am
Well they only want mixed babies if the father is white, because even if they won’t admit it they believe them to be more attractive.
Reply
-2Haha says:
Tuesday, September 22, 2009 at 12:46 pm
More attractive than a steaming turd? Perhaps.
Pencil neck, cow eyes, lanky, gap-toothed, retarded… this is a white man.
Reply
MOE says:
Tuesday, September 22, 2009 at 7:43 pm
so much rascism coming fromt he country that was so proad to host the olympic games and to say one world one dream.
Reply
-1Asian loves Black says:
Wednesday, September 23, 2009 at 8:47 am
Banana Ripper
Are you an idiot ? what exactly are you trying to say ?
Every races have their own culture and values. My caucasian friends doesnt take care of their grand parents, left them to take care for themselves, and at one point one of my friends was saying he was disappointed because he didnt get much in the will. These caucasion friends will actually sell stuff to their parents and grandparents, eg. old pc gears for a mere few hundred bucks.
Would I jump into conclusion and say that my friends are ungrateful a$$holes. NO because thats the way that they were brought up with, thats their believes and values. I RESPECT the differences, but would I do that to my own parents, answer is NO, because asian cultures we take care of the oldies. By this I dont mean to say asian are better, but I just want to point out that every races have their own values and ethics.
Now back to the the black white yellow and the brown discussion, I said I would respect anyone who want to mix with different color. I would definately respect and work with any color on a professional level, however on a more personal level, sexually, aesthetically, I prefer to mix with people that of my own kind, and color (or a lighter color). and there is nothing ignorance about that.
Most of the time I would see a black male with a non black color partner why is that ? may be aesthetically black female are not as attractive as other races hences the black guy want to be with a non black partner, this is evolution at work, other races left africa millions of years ago and changes their skin color, now its time the blacks from africa playing catching up. This is a fact of life. Everyone is racist in their own way because each of us have our own prejudices and preferences. Stop trying to sound like an angel, because if everyone loves everyone elses there would be no war, no border between countries, no diferent religions, no kid would dies cos of hunger while millions of others have too much of everything, there would be no factory in china where most people earn a few dollars a days, where as ppl like me doing jackshit in an office here in the western world, got online arguing over the internet over some non matter crap and get paid a few hundred times more than those in 3rd world countries.
Now please tell me that I am being ignorance or this this world is not fair and not everyone is equal, and all of this is because each of us is racist in our own way.
Reply
Carlos says:
Friday, October 23, 2009 at 6:00 am
Moron!
Reply
+1American says:
Thursday, September 24, 2009 at 10:38 am
So her crime is that her mother hooked up with a black man while married and as a result had a black child? It would be lesser offense if her mother had the affair with another Chinese man?
You all give a great impression of Chinese people.
– An American.
Reply
white girl says:
Saturday, September 26, 2009 at 7:48 am
Thank god I’m not from China. This girl is more beautiful than any chink I’ve ever seen AND has more talent. I feel bad for her to be judged for something that isn’t her fault.
Reply
El oh el says:
Tuesday, November 17, 2009 at 11:13 am
Has more talent?! Did you hear her sing? She doesn’t have any talent!
But you know, she is a chink with a deep tan and her mom is a chink, so good going there
LOL at you calling people chinks/ ugly and then your “I feel bad for her to be judged for something that isn’t her fault”. I’m sure you can’t grasp what’s wrong with that…
You black monkey lovers are so stupid it gives me a headache
Reply
Jan says:
Saturday, September 26, 2009 at 7:53 am
Grow up and leave this girl alone. She is a HUMAN BEING and should be treated as such. You ignorant racists make me sick. You all should be wiped from the face of the earth, so it is a better place!
Reply
+1thomas in california,usa says:
Saturday, September 26, 2009 at 9:48 am
CHINA WAS COMMUNISM,
WHICH IT SYSTEM MAKE PEOPLE BRAIN WASH,
THOSE SOCIETY ONLY ONE WAY,AND LIVING NO CHOICE OF LIVE,
RACISM AS MOST OF THEM, THEY NEVER KNOW WHAT IS OUT SIDE CHINA,THEY DID NOT KNOW MEANING OF “INONOCENT” “HUMAN”
SHE NOTHING TO DO WITH HER PARENT,
HER TALENT NOTHING TO DO WITH HER SKIN,
WAKE UP,OPEN YOUR EYES TO SEE THE WORLD TODAY,
Reply
+1bruce says:
Saturday, September 26, 2009 at 12:17 pm
lots of racist people on here. And Chinese people are racist towards blacks, and also towards other asians that have darker skin than they do. In China the darker you are, the more lower class you are considered. My wife is from China and I have visited there many times. I know their culture. There are a lot of very stupid racist people on this website. You all should be ashamed.
Reply
Jay says:
Saturday, September 26, 2009 at 5:48 pm
It’s funny to hear and see how racist Chinese people can be. I can’t wait to show this to all of my friends…perhaps we will purchase a plane ticket and come over and visit you all. I hope Lou Jing wins!
Shame on you bigots!
Reply
-8Mr. F. King Knowitall says:
Saturday, September 26, 2009 at 7:19 pm
1. I applaud the Chinese who are not tricked to act like fools by American liberal media.
2. Mother is a slut whore and should not be allowed on TV
3. Do not mix good Chinese beauty with dirty black.
Chinese + Chinese = Chinese baby
Black + Black = Black baby
Black + Chinese = Black baby
4. In words of Louis Farrakhan (famous anti-white black man) who said: “Half black equals all black!”
5. Black girl speak Chinese and use chop sticks is still black, not Chinese.
6. Horse + mule = jack ass, not horse
7. Shame on Oriental Angels for putting this black girl on TV! Why not just make the show in America or Africa!
8. It is not wrong to be proud of your race and not want to pollute your gene pool with black. Keep black out of China!
9. Is it too late for slut mother to get an abortion?
Reply
Wretchedofthepond says:
Saturday, September 26, 2009 at 7:48 pm
If you feel that way, don’t be surprised if you happen to get chased back to China when you try your hand at leeching off of the American Community College system (and riding much white cock while you’re at it).
Reply
+1Angie says:
Sunday, September 27, 2009 at 1:26 am
Racist like you are the ones polluting our society.
Reply
bleah says:
Sunday, September 27, 2009 at 4:28 am
9. Is it too late for slut mother to get an abortion?
Nope, it works also repercussivly.
Reply
Carlos says:
Tuesday, October 20, 2009 at 5:47 am
Sick fucker!. Maybe someone should have aborted your mother. That would have been the best solution.
Reply
trunks says:
Thursday, November 5, 2009 at 2:58 pm
it’s wrong to demean my people! and you mean keep china out of black. we don’t need you either.and fuck you for calling my people dirty you bastard!
Reply
+1Wretchedofthepond says:
Saturday, September 26, 2009 at 7:45 pm
I love this shit. We got black fighting white, fighting yellow, fighting white. ROCK-PAPER-SCISSORS!!!! FUCK YEAH!!!!!!!!!!
Reply
mary says:
Saturday, September 26, 2009 at 9:45 pm
Who are you people? You know nothing about the US and even less about Black people. Since when does the US have a Black population of 60%? The largest minority group in the US is Hispanic and the only make up 14% of the population. It such a shame you can’t just appreciate this talented young woman and not be caught up by something so superficial as her skin. Shame on you all! And stop spreading your ignorant lies.
Reply
est says:
Saturday, September 26, 2009 at 10:30 pm
This is stereotype. Have you guys looked at the comments to 丁慧?
Reply
-1Vancouver says:
Saturday, September 26, 2009 at 10:57 pm
She’s much more attractive than ANY full blooded chinese girl.
Reply
MingMing says:
Monday, November 2, 2009 at 6:00 am
Funny you said that, since Vancouver is full of hongers.
Reply
El oh el says:
Tuesday, November 17, 2009 at 11:09 am
Butt hurt monkey I see
Reply
Dine says:
Saturday, September 26, 2009 at 11:11 pm
This is totally Racism!!! Everyone will make mistake in life at some point. The woman make mistake in the beginning but thats her own destiny.. What is your own business people??? All you know is to judge people’s mistake!!! Face your own life assholes.. Leave the beautiful baby and her mother alone!!! God sometimes make ugly occasions like this a blessing.. I know this child is a blessing to her country and to her mother. Back off FAGGOTS!!! I know you all do not have big balls in your pants thats why you hating the black guys.. Shame on you all.. God is greater than you.. ALL HATING FOR FAKE REASON.. People married, people get divorce, so what??
Reply
+1aussie says:
Sunday, September 27, 2009 at 5:47 pm
Its ironic you have to revert to homophobia in order denounce racism.
Reply
+2Sophia says:
Saturday, September 26, 2009 at 11:14 pm
I am Chinese-American, and these comments make me ashamed of my Asian side. It’s this backward attitude that made the Beijing Olympics a worldwide laughing-stock instead of the international symbol of unity and global respect it was meant to be.
The world is becoming more diverse. In 100 years, we will all be one color: beige. The sooner your country can accept this reality, the sooner you can join the rest of us in the First World.
In America and Europe, the biracial/interracial population is not only growing, but encouraged. Mixed people are beautiful and interesting, including Lou Jing.
In my country, a half-black person raised by a single person can become president. When will you guys catch up?
Reply
+1bleah says:
Sunday, September 27, 2009 at 4:36 am
In 100 years, we will all be one color: beige.
First of all, 100 years is a f*cken short time. Second, did you had genetics in school? Did you learn about dominant and recessive alleles and solve Punnet squares? For ‘beige’ it takes a little bit more (but that goes beyond the high school biology theory).
Reply
orly says:
Sunday, September 27, 2009 at 4:44 am
I’m loving most of these comments. Really eye-opening and informative. It’s great to see humanity progressing along at such a rapid clip.
Maybe next we’ll grow thumbs or something. Doubtful, but possible!
Reply
+1wtf says:
Sunday, September 27, 2009 at 7:25 am
???
This entire article has validated my opinion that USA dominates over China in every aspect of life.
Get your facts right.
Americans got over the interracial issues a long time ago.
Reply
+1Haha says:
Sunday, September 27, 2009 at 8:07 am
Yes that’s why so many black/white couples are attacked and sometimes murdered.
Stupid fuck.
Reply
Leviathan says:
Sunday, September 27, 2009 at 11:01 am
A dose of reality
To all the Chinese knocking this girl (and objectively she is pretty), after you finish drinking all the propaganda the govt. feeds you, ask yourself some basic questions?
1) Name an attractive Chinese male (no, not in China, a Chinese man that is considered chinese in ANY Western country?) Just name one.
2) What is the name of that famous Chinese that won the nobel prize?
you guys are a joke. Wake up. In every Western country, the Chinese are an underclass: dont believe me, visit China town.
Reply
El oh el says:
Tuesday, November 17, 2009 at 11:07 am
Actually statistically they do better than all the other races in America, including Whites and definitely better than Blacks. Good job on that one.
Reply
KJ says:
Sunday, September 27, 2009 at 2:06 pm
I have to agree with White Girl. Lou Jing is the most beautiful thing to ever come out of China. You are insane.
Reply
+2xichlo says:
Sunday, September 27, 2009 at 3:12 pm
“one multicultural and multiracial society in harmony” made in china.
be alert the world !!!!
Reply
+1aussie says:
Sunday, September 27, 2009 at 5:25 pm
I am not surprised at all, I visited China last year and it appears as though China really wants the title of most racist country. Although India might have something to say about that, India does not kill and persecute its racial minorities. All those who are astonished, did you really expect anything different from a country that has committed ethnocide on the Tibetans and the Uighurs.
Reply
+2David says:
Sunday, September 27, 2009 at 6:24 pm
I am sick and tried of this subject!!! BLACK MAN OR THIS AND THAT all BLACK MAN or no good YOU PEOPLE MAKE ME SICK! Its not the colour of someone skin!!!! God how dumb are you people!!!! ok this is my story !!
Yes I am a young black guy 28 I have a career! And my own business I live in the London I met this Chinese girl, and for two year were together ( I told her we should marry as I was in love with her she could not marry me as she would lose her family, friends and face!! As she put it!! ( just to put this now down yes we all know Chinese are racist you hate yourself more then black or whites and that a fact!!)
She fell pregnant and I said to her lets have the baby I was so fun!! !! Please do not kill it!! I begged her to keep it!! I have money; I have a good home and family that love her!! She the CHINESE GIRL WENT AND KILLED THE baby (abortion) I will never forget this feeling!! I told her before she did it I will not leave you!! I will be here for ever with you!! I will do my best!!(I did her a visa, got her a lawyer, moved her in to her own flat) SO WHEN YOU PEOPLE IN HERE say black men fuck you and leave you can all go to hell!! You watch one film, tv show and say all black men are bad YOU are the evil ones!! It’s not the colour of someone but the person him or herself!!
If you’re good your good if you’re bad you’re bad!! And this girl’s dad was an asshole for leaving his kid!! (When I marry that’s for life and when I get kids that for life!! I would never leave my kids, I had a mum and dad) back to my story One of her best friends stops talking to her and just talks to me!!( her best friend ever said she’s a evil and stupid person! And informed me that I should never talk to her again and I will do as her friend said) This Chinese girl is just here in London fucking who ever she wants with her gay friends doing what ever!!
So as you can see you Chinese women are not all sent from heaven some of you like white or black or Asian are FROM HELL!! Like this girl’s dad) my Ex Chinese girl friend could not handle a long term relationships!! I found out that she has a husband in china!! Poor guy I fuck his wife!! So the point is it’s not black or white, anyone can be a devil!!!
And yes this girl has been calling me to get back she’s calling my sister and mum!! I will never go with that killer if my mum knew what she has done!!
Why do Chinese women have so many abortions!! Like it’s a game!! Now that’s evil!!
Reply
aussie says:
Sunday, September 27, 2009 at 6:59 pm
I am surprised you have a business. Someone else must have filled out the tax and legal forms, especially in a common law country. “I did her a visa,” can you do me a visa I want to backpack through Europe next year.
Reply
+1David says:
Sunday, September 27, 2009 at 9:17 pm
Haha lol Sorry I was just going on and on I let my feelings out I am just so pissed off with this stupid subject ok just for you AUSSIE
I have a family lawyer that’s very good ! I took her to see him, she had it all done within 8 weeks, she was in a mess and would have been sent back to china, so I took her to his home !!! anyway if you need help and you’re in London I can send you his way. Email me!
Sorry Aussie I have chilled down now! Lol take care of yourself
Reply
El oh el says:
Tuesday, November 17, 2009 at 11:03 am
Nice grammar and cool story bro
Reply
+1David says:
Sunday, September 27, 2009 at 9:26 pm
PS: AUSSIE TAX HERE IS A BITCH !! I do get help with it !! your right!! hahah lolol I have a friend from NZ and he is backpack through Europe i helped him out so many times hes in Italy!! right now he called me then i called him (cost) last week!! hes loving it!!
Reply
+3AngerPersonified says:
Sunday, September 27, 2009 at 11:43 pm
you fucking pieces of trash. no wonder s. korea and japan look down upon the chinese..
i wish you would catch cancer and die. youre the worst kind of ignorant trash! the kind that dont know theyre racist.
now I know that some of the postings have been given a terse, almost stilted translation but thats no excuse.
well let’s see if you’re as good as taking it as you giving it.
you primitive, shit eating, smelly, yellow pieces of commie filth. no wonder the hong kong chinese and the taiwanese despise you. you’re a bunch of uneducated hillbilly trash.
go back to the countryside you filthy, ignorant bumpkins
Reply
MingMing says:
Monday, November 2, 2009 at 6:04 am
Dude, Koreans are pretty racist, too.
Reply
China Sucks says:
Monday, September 28, 2009 at 2:06 am
Why are gooks so racist? Leave the girl alone.
Now stop typing on this website and finish up my Kung Pao Chicken order. I have been waiting patiently.
I also have a calculus exam coming up. Are you zipperheads tutors? I heard you are all good at math but severly lack social skills.
Reply
El oh el says:
Tuesday, November 17, 2009 at 11:00 am
I didn’t know monkeys like you knew how the use a computer. Silly jiggaboo. Stop using massa’s computer and eating his watermelon and go finish picking the cotton field before he turns you in to a christmas ornament if you catch my drift.
Reply
Nathan says:
Monday, September 28, 2009 at 11:15 am
As a “mixed-race” person myself(English-South African) who has traveled to many countries around the world and lived in a very cosmopolitan city for most of my life I would say that with most people their level of racism closely correlates with their level of insecurity and aspiration to get ahead in society. I would guess that that the majority of Chinese people with access to the internet and on these fora consist of mainly this newly “middle class” and insecure type.
Reply
-2cheech says:
Monday, September 28, 2009 at 2:11 pm
Her slutty mom likes the big black dick. I wonder if she also swallows. Maybe she gurgled the semen before stuffing it in her lily white Shanghainese vagina. Yummy.
Reply
Ying-Sau says:
Monday, September 28, 2009 at 4:54 pm
Ok, so I saw this site by accident; But being black I’m just appalled by these chinese racists. Now, being a stereotypical black person, knowing how racist all chinese are, let me go and gather my gang and go find some racist chinese to beat down! – while i’m at it, i’m gonna tell all my friends about this site, so it goes global so all the blacks everywhere will know how racist chinese are, and they can get their gangs and go and beat down some chinese. – Well it is the internet ain’t it? – Just a bunch of yellow frogs stuck in the well! – And of course I don’t mean all chinese ;-)
Reply
Ying-Sau says:
Monday, September 28, 2009 at 4:59 pm
Now I know (i was being naieve before) why most of my HK friends don’t like to go to china.
Reply
-1Asian American (aka RichWhiteMale & PRC Fenqing) says:
Thursday, October 1, 2009 at 12:59 am
Ying-Sau
Blacks are poor and stupid
Go kill some Chinese. I don’t care. It will only reflect on the true nature of barbaric black people. Every civilised person in america knows u guys are up to no good.
All about gangs, drugs, HIV/AIDS, basketball and on welfare.
Reply
Alvin says:
Tuesday, September 29, 2009 at 6:47 am
Wow… I’m chinese and after reading this… I have to say i’m quite ashamed of my own race. Not Lou Jing or her mother but all the racism and negative comments toward them two. It’s not the girl’s fault, and her mother’s mistake shouldn’t be pulled into this. We’re all human beings in this world. And to the people that say her mother ruined her life? She did not. It’s the people that are racist towards her in this type of situation that is.
Reply
-2Haha says:
Tuesday, September 29, 2009 at 10:03 am
Oh? You’re “ashamed of your race”? How pathetic, are whites ashamed of their race for the Holocaust?
Reply
Eric says:
Wednesday, September 30, 2009 at 12:50 am
chinese or asian people are to blame for racism. You look at how asians treat whites in such a good way. But there is a air of jealously of wealth. AS east gets richer and west gets poorer, I’m sure this colonial mentality will change
Reply
kiki says:
Tuesday, September 29, 2009 at 9:27 am
I think she should tryout for China’s next top model instead of a singing competition.
Reply
+2Wuliao says:
Tuesday, September 29, 2009 at 9:39 am
I totally agree with you, Alvin.
I actually admire the girl. She’s very brave and beautiful especially when she sings “Shagua Dou Yiyang” with the sunny smile and confidence in the Youku video.
And her mom is there to support her no matter what.
Reply
jds says:
Tuesday, September 29, 2009 at 11:30 pm
i don’t understand the idea that a chinese woman should marry a broke chinese guy with a small penis. if she can marry a richer better endowed guy guy whohappens to not be chinese she should go for.look at an obama type: yale educated successful articulate RICH.how would a chinese woman be better off with one of the 90% of chinese men who don’t go to college?
Reply
-1Eric says:
Wednesday, September 30, 2009 at 12:48 am
jds
please. how is this not reek racism
you must be black male. I can easily start going off what i think about blacks
Reply
-5Asian American (aka RichWhiteMale & PRC Fenqing) says:
Thursday, October 1, 2009 at 12:56 am
Oh Please
We Asian Americans all know that blacks are the dumbest. Go back to playing football. If it wasnt for basketball and football scholarships u guys wouldnt have even gone to college.
Yes Obama is from Yale. Yale has less than 5% black population. Chinese make up almost 20% of Yale. Asians make up close to 35%.
Reply
Mike says:
Tuesday, October 6, 2009 at 4:00 pm
If it wasn’t for the black civil rights struggle you’d be cleaning toilets instead of attending Ivy League Universities. Stupid gook.
Reply
MingMing says:
Monday, November 2, 2009 at 6:07 am
Gooks are Koreans. Learn your racist terms.
Reply
+1Carlos says:
Friday, October 23, 2009 at 5:52 am
Another whiner guy, who was jilted by his girlfriend for Blackman..lol
…and probably by a Football player.
Reply
rosebelle says:
Wednesday, September 30, 2009 at 5:50 am
Everyone is judgemental and racist in our own ways. Believe it or not, it’s true. We all have our opinions and some people are just more controversial and opinionated then others. I have worked in a diverse workplace and what I can tell you is, every ethnicity has its own stereotype of other groups. There is one black woman in her mid 60’s who thinks that every single person on this planet knows the word “n**ger”. She also said that because she is much fairer than other blacks, she gets discriminated and hated on by darker skin black people too. And her mother despises dark skin blacks. So see, racism exists within the same ethnic group and culture.
Reply
Mandi says:
Thursday, October 1, 2009 at 2:35 am
The dunbest comments I have seen ever regarding a black chinese, born and raised in china.
Doesn’t matter how she came on this world. She has nothing to do with that. Besides she is a human being like everyone else. Threat her like one.
Honestly i find all this discussion stupid. It only refelcts how stupid the comentators are. I don’t want to generalize for all the Chinese population.
It would be said to think all of China would/should think like this.
Needy to say. This girl is hot. Gorgeous!!!
A dream to many men.
Reply
+1Aish says:
Thursday, October 1, 2009 at 3:45 am
this is just tragic. That poor girl has done nothing to warrant being treated like this. Lou, my prayers go out to you.
Reply
+3Josh says:
Thursday, October 1, 2009 at 12:15 pm
WOW!
First of all, she is BEAUTIFUL!
Secondly, you guys ought to be ashamed of yourself for posting the racist comments that you have posted here. What you forget is the fact that she is first and foremost a human being and she had nothing to do with her mother’s choices.
As an Asian who’s been forever trying to defend Asians in America, I am disgusted by your attitude. You are shameless and ignorant. Not to mention stupid.
Peace.
Reply
-1Nero says:
Friday, October 2, 2009 at 4:28 am
Its hilarious that Chinese netizens think they are somehow superior to black people. I can understand the cultural shock- but as a people historically subjugated just as often as blacks, i do not see how you can look down on blacks.
Reply
+1Sausageroll says:
Saturday, October 3, 2009 at 3:15 am
I wonder if Lou Jing realises how well regarded blackinese people are in the fashion world.
She is smoking hot!
Reply
+1Cho Tau says:
Sunday, October 4, 2009 at 9:16 am
Extreme Nationalism will soon become fascism. I fear that China will become a new Nazi Germany at this rate.
Reply
+1William says:
Sunday, October 4, 2009 at 10:53 am
I think it is a terrible thing to attack or blame this girl for anything. She is who she is and it is not at all her fault. I think she is quite attractive and probably far more attractive than the jealous idiots who criticize her.
There is much of great beauty in Chinese culture, but the racism displayed by some here is not pretty at all.
Reply
Morpheus says:
Monday, October 5, 2009 at 12:38 pm
Ok, have to comment. You ignorant, third world Chinese racist fucks with delusions of anything but servitude to the Japanese and Koreans need to recognize beauty. This girl is stunning, her mother has stones that few Chinese robots could ever muster, and to the dumb bitch that thinks black and yellow mixing is gross, go buy a knock off iPod, sit down, shut up, and realize you are nothing and be done with your miserable life.
Reply
Morpheus says:
Monday, October 5, 2009 at 12:48 pm
Now that I got that off of my chest, for a more reasonable response to the racists…
China is either going to join the world stage or it is going to sit on the periphery. The same can be said for the Middle East.
Lou Jing is stunning. Her mother was courageous in keeping the child and maybe if Chinese men treated their Chinese women a little better, this woman wouldn’t have wandered into the bed of a black man passing through as it were.
We all know what happened. No great mystery here. But to put this much hate and effort into a young woman who had sweet F-A to do with her parents rutting (look it up)is truly pathetic. Underscores the vast divide between the individualism of the West and the robot-like conformity of the East.
Needs to be a happy medium.
Anywhoozle, I suspect that more than a couple of the ‘netizines’ hating on her a a bit jealous that she’s turned her reality into fame.
Advice to her: come to the UK or America, you’ll be Paris Hilton’s new best friend inside a week. Bring your mother as well, lots of more open-minded Chinese abroad.
Reply
+1Lou Wei says:
Wednesday, October 7, 2009 at 7:16 pm
Lou Jing – sweetheart, come to America. You’ll be a star within a week. You are stunning!
Reply
+1Brody says:
Tuesday, October 6, 2009 at 6:07 am
Here in Los Angeles, Chinese immigrants and students are meek and deferential toward black people. So the racism is not inbred but opportunistic when the cowards know they have a billion people backing them up.
Reply
-2Johnny says:
Tuesday, October 6, 2009 at 2:27 pm
Chinese are the sick men of Asia. And apparently they’ve never heard of oral hygiene. Hell, even the chink government had to tell them not to spit on the sidewalks or urinate in public during the Olympics. And unless you want to die from shock never go into a Chinese bathroom. They never clean it. Oh, the horror.
I think we should reinstate the Chinese Exclusion Laws to keep these filthy Chinamen out. There was a time in this country when Chinamen were considered lower than dogs. Those were the good old days
Reply
-3Smokey says:
Wednesday, October 7, 2009 at 2:57 am
And I hope you and your progeny are cursed and all go to hell, you smug white piece of shit. Die, you and your whole shitty cave monkey race with a dick in your mouth, fuckin piece of shit. That’s why me and my friends love to target you white pieces of shit on the street. Be careful when u walk out the club, all of you!!! No rhythm having soul-less unevolved freaks.
Reply
+2HalleBerry says:
Wednesday, October 7, 2009 at 12:39 am
To JAMIE:THANK YOU! Preach it sister! And to those 2 pricks with their mouths on each others DICKS ‘J’ and ‘Chinajim’ get you shit straight fucktards there are WHITE PEOPLE on welfare shitholes just like there are verrrrrrry SHITTY white neighborhoods and there are white drug dealers,deadbeat dads,wife beaters,child predators,SREIAL KILLERS,dirty cops,etc. so you 2 dumb bitches are in NO postion to judge! And for those bringing up Obama and least unlike our last president he EARNED his education and didn’t have ‘daddy’ make phone calls to get him into Yale because he was too much of a dumbfuck to get to ANY college on his own. Plus had a history of drug and alcohol abuse that daddy also made go away most people with even HALF of the shit Bushy Jr. had on his rap sheet couldn’t get a damn job scrubbing toilets much less become president of America. Nor could the COUNTLESS white males who have daddy,granddad,brother,uncle,cousin,daddy-in-law giving them jobs depsite being no smarter than a tick on a dead dog’s ass. Or the many,many,many,MANY stories of white male perverts with little girls in their basement or cellar fucking them and making illicit,mud babies out of their sicko perversions. Like a certain father who kept his OWN DAUGHTER PRISONER while having sex and chidren with her while mom whistled and obliviously happy tune. If I had a dollar for all the stories that I hear about fucked up white males killing their mom then eating her bones,plotting against the govenrment and shooting ATF agents,kidnapping then raping underage girls,starring on ‘To Catch a Predator,Catholic priests,shooting a former job or place of business,shooting a business cause his ex works there,just shooting period,having babies out of wedlock with their cousin/sister/wife,having 8 teeth on one side,ruining companies with insider schemes,politicians having affairs with prostitutes/interns/cleaning ladies/wives’ sisters,crackhead celebrities who drive drunk and kill people yet get PROBATION,and the like I be a rich woman indeed! The bottom line is you cocksuckers NEVER want to acknowledge any of the shit you do so don’t come here with your little dick and statistics lest you want them thrown back at you!
Reply
-1Smokey says:
Wednesday, October 7, 2009 at 2:53 am
There is so much hate, but the wrong kind. We should hate the foreign oppressors who are so smug in our own country, not some poor girl who’s mama just happened to bang a black man. What about all these race traitors who bang whiteboys? Where is the persecution they deserve? Leave her the F alone!
Reply
-2Smokey says:
Wednesday, October 7, 2009 at 3:06 am
We need to stop sucking jap and gook dick, and have pride in our nationals whoever they may be. And fuck you race traitor in HK and TW who think you are better than your brothers. If we cannot have unity we will all die. At least the blacks I’ve met in L.A. aren’t as cocky and smug as the assholes in the Valley. We need to start hating the right people, not those who don’t have much to do with us. Fuckin Spics are trying to drive us out our turf, whiteboys talking endless shit in the media and in secret, and we hate blacks!? Sure, there are some nigger bastards out there, but in reality the people who fuck with us the most are Japs, Gooks, island monkey traitor chinks, crackers, and Spics!!! But I digress, Fuck u all!!
Reply
NameLess says:
Wednesday, October 7, 2009 at 1:31 pm
What is the problem with the kid guys? She has nothing to do with her parent dilemma. So why u guys keep blaming on her base mom had affair with the African-American. Don’t u guys ever look at difference angles. It can be her ex-husband problem, may be he is useless or his dick too small that cannot satisfy his wife.
Reply
+1Lin Wei says:
Wednesday, October 7, 2009 at 7:02 pm
Wow…Chinese people are racist as hell. What a backwards group! You have a very looooong way to go in terms of enlightment. You make being of mixed heritage sound like a disease, and my god how quick you are to throw around words like “slut” “bitch” and “whore”.
So not only are too many of you racist lunatics but you’re sexist too! Here’s a clue: it’s 2009, grow the fuck up and catch up with the rest of the world on the subject of race and gender. God help you all…
Reply
nicole h says:
Thursday, October 8, 2009 at 6:40 am
“clap,clap,clap!” THANK YOU! that is just what people need to hear.i am mixed race.my father is mexican american and my mom is european american.even though my father was never around i have had pride in my nationalties.there is nothing wrong with being mixed.there is nothing wrong with any race.
Reply
nisha says:
Thursday, October 8, 2009 at 3:35 am
Every one who has something negative to say are so ignorant…Black people have been discriminated against for so long and it has never brought anything good. No matter how smart or well you may be at your studies, you are still so stupid to think there is anything wrong with african americans.
Reply
nicole h says:
Thursday, October 8, 2009 at 6:35 am
I don’t understand how anyone can say what they have said due to the race of this girl.I think it is wrong that so many people have bad things to say about this girl.But then again and this is not intented to be disreptful but in other counties(i am from America)and some people here think that being mixed is wrong and that they look down on people who are colored.Since 9/11 a lot of Americans turned their backs on Musliams.Racism has been around for a long time and there has never been any good from it.This girl is born and raised in your country.You should be proud someone so beautiful and talented from your country.
Reply
lol19 says:
Thursday, October 8, 2009 at 2:15 pm
racism is racism. whether comments be subtle or hidden well its still racism people we live in the 21st century.
maybe all of you making racist comments about how this girl is ugly or yellow mixed with black is gross should take a good look at yourselves and realize that the stupid speech coming from your mouth makes you more gross or disgusting than this beautiful girl could ever be. its comments like some of those posted here that chinese remain in the old days unable to progress to bigger better people.
Reply
+1The Supreme Being says:
Friday, October 9, 2009 at 3:56 am
Peace.
I see alot of people have forgotten their history and have adopted the ideas of their oppressors. I also see alot of people lack a knowledge of who they are and their origin in this world, and when a person lacks the knowledge of self, they also lack respect for themselves. When a person doesn’t have self respect they can’t respect other people and I can easily see the lack of respect many of you have. Genetically…..everybody comes from BLACK people even the chinese. As a matter of fact it was BLACK (so-called African) people who established civilization on the part of the planet now called China.
It’s funny how the chinese in this day in time love and worship the devil (white people) and the very same people they love and worship, love and worship BLACK people and hate themselves.
It’s a bizarre world, I know I know.
The Original Man is the Asiatic Black Man, the maker the owner the cream of the planet Earth father of civilization and GOD OF THE UNIVERSE.
The Original Man is the Black Man and the Black Man comes in many shades of BLACK…..Black, Brown, and Yellow.
The chinese have been lead in the wrong direction along with the rest of the world and their ignorance shines through, but it’ll never outshine the truth for these people responding in a disrespectful manner is only showing their true colored nature.
Respect the architect….which is none other than the Black Man.
Reply
Hansolo says:
Saturday, October 24, 2009 at 7:55 pm
If they keep digging in Africa they won’t find any white man there just the black man.
Do they really know the true color of the Original Man?
Reply
kenneth says:
Friday, October 9, 2009 at 5:30 am
Too bad many Chinese and the world see dark skin as something of a curse. God created us all and one day, we all will be judged. This is a beautiful lady. Yao Ming was treated like a king in America. No one gave a crap about what color he was. They cared about his talent. Sure Kobe Bryant is loved in China. Why? he’s black. This young lady father needs to be in her life. China has many people behind her, only the Ignorant stupid bastards would say cause this Human Being pain.
Reply
king says:
Friday, October 9, 2009 at 11:55 pm
asian women have flat azzez & their men all pretend to be black,their whole race is a wanna be race. some wanna b black, some wanna be white none wanna b flat face, flat azz, ugly asian lol
Reply
+2Fike2308 says:
Tuesday, October 20, 2009 at 11:07 am
King actually makes a good point because I’ve noticed that a lot of Asians try to imitate black clothes…listening to rap, playing basketball, taking hip hop dance lessons, etc.
Chinese people hate blacks but love the NBA and Kobe…how does that work??
Reply
+1Carlos says:
Wednesday, October 21, 2009 at 8:29 am
Of course, They love the NBA and Hip Hop, most can’t dance anyway. They love Beyonce, love Kanye and Jay Z, have their pants hanging low, but want to talk shit about Blacks, amazing and totally ignorant. Chinese people always love to boast about how high(yawn)their IQ is, but socially, its lower than a Snakes belly!
Reply
Jimmy says:
Tuesday, October 13, 2009 at 12:48 am
I am pretty sure that if it is a white man, the daughter would be love by many men in China even though she is mixed.
Reply
Henning says:
Wednesday, October 14, 2009 at 4:31 pm
so sad the Great Firewall doesn’t block trolls
Reply
-1wgh says:
Thursday, October 15, 2009 at 1:51 am
There is fking absolutely wrong with her! In fact, she’s quite pretty! All Chinese rednecks should go jump of the cliff!
Reply
-1Dad says:
Thursday, October 15, 2009 at 9:09 pm
Big China! Big mistake chinese people! Big mistake…
Reply
+2AFRIKAN MAN says:
Sunday, October 18, 2009 at 12:46 am
Well. Well. Well. It never cease to amaze me how the internet gives racist indiviuals an avenue to vent their illogical frustrastions. If, anyone on this post who has the intellectual capability to observse closely the negative statements made towards Afrikan people. You will immediately see that none of it is based on substantiated facts. Only, statements based on raw emotion that is fueled by a convoluted superiority complex.
Asian men that have given responses on this board quite often mention the sexual gifts of the Afrikan man. Which has all been in a positive light, although the main body of the racist rants is bullshit. But why? It is a direct reflection of their own inferiority complex of not be able to satisfy their own women. Not, being able to do so, physically, emotionally and spiritually. So,their women seek pleasure in the one that can. THE AFRIKAN MAN!!!!!! It is no mystery in how asian men have treated their women throughout human history. From the acts of foot-binding, domestic violence, and lack of emotional avaiability. Just to mentioned a few!
Subconsciously, the asian man knows full well, that the Afrikan man is the superior man in every way. Why else would a person waste so much of his time spitting hatred about a particular race? “That which is most hated, is that which is most desired.”
The July/September issue of BBC Focus on Africa, there is a article that validates my claims accordingly. The article is: Walking Tall:Lloyd Amoah reports on the status of the Afrikan male…in China. It is about a young Afrikan man who marries his college sweetheart and starts a family. In the article he mentions the following “Chinese women find us exotic. They are fascinated by our large eyes, thick eyebrows, long eyelashes and our height.”
Also, “Courtship is a journey of passion and that leads the Chinese women to believe that we (Afrikan Men) show more affection and are more romantic.” Of, course he mentions the racist nonsensical behavior of chinese men, but from this message board we can see that that is quite obvious.
But, that is only from the Afrikan man. Now the asian man is pissed all to hell, because of Old Man Caucasian is taken his women as well. Leaving him with nothing more than spending nights masturbating infront of the mirror crying “WHY!!! WHY!!! WHY!! DAMN IT!!! WHY!!!
Let’s face asian man!!! Your women out number you in China, and the constant abuse of them has worn it self dry. It is a brave new world and educated women from all over China are exercising their right to choose what is best for them. Not what some insecure man who has no other idea to explicate his manhood than showing bullshit bravado.
And, from the asian women i’ve had the opportunity to conversate with many are looking for something new. Where genuine love is a big variable in that equation. So, you. The asian man can do something to aleviate your physical, emotional, and sexual deprivation. What is that you might ask?
The Afrikan women!!! Since many of you fascinate about her superior curves. That could possibly be your ticket to salvation. But!!! There is one factor that will most likely create a hinderance for you. THAT PENIS SIZE!!! OH!!! YEAH!!! THOUGHT I DIDN’T KNOW!!!! I’ve heard horror stories about your problem!!! What is it: only 2 inches when erect!!! As, we say in the African American Vernacular “WHA DA FUCK YO!!!!!! HA!!! HA!!!!
I guess you asian men should invest in some penis pumps, but that is only for immediate erection purposes only. Not for longevity!!! SORRY!!!! Well, since that is the case i recommnend you stick to what you know best: Shrimp Fried Rice and Miso Soup!!!!! And, i will admit that is some GOOD SHIT!!! THANK YOU ASIAN MAN!!!! YOUR THE BEST!!!!
But, in all fairness it is sad they we a people have to constantly make nonsensical statements about people we have no knowledge of except what we have been told. Which, let’s me know that the enlightement of humanity is long way from be accomplished.
Take care!!!
Reply
-1Hansolo says:
Sunday, October 25, 2009 at 10:00 am
“Asian men that have given responses on this board quite often mention the sexual gifts of the Afrikan man……………the main body of the racist rants is bullshit. But why? It is a direct reflection of their own inferiority complex of not be able to satisfy their own women. Not, being able to do so, physically, emotionally and spiritually.”
May be so but the Chinese men have a new new weapon mow and it is as big as a horse’s penis.
Have you notice that many Chinese small old ugly guys have good looking hot and sexy Chinese babes for a wife, you may ask why?
These small Chinese guys have something in their pants like a big wad of cash in thousand dollar bill$ all rolled up bigger and fatter than any black men’s gift.
The playing field is all even again for now.
Reply
meimei says:
Tuesday, November 3, 2009 at 9:43 pm
Many fenqing loser are homosexual because they can’t get girl. they are jelous wanting giant black snake.
Reply
+1Tommie Dynamite says:
Sunday, October 18, 2009 at 9:01 am
I never knew Chinese people were SO RACIST!!!!! I wonder if Lou Jing’s mother had an affair with a fucking honkey cracker would she be so ostracized by those pie faced, slanty eyed gooks. Asian people love white people. Asians are the white man’s whores. Lou Jing needs to come to America and be with black people who will love and accept her. She’s a beautiful black woman. Black people aren’t animals. It wasn’t black people who bombed Nagasaki and Hiroshima. It wasn’t black people who killed over 6 million jews. Black people didn’t enslave themselves. Black people didn’t destroy the World Trade Center in New York. Blacks didn’t start every war in the history of the world. WHITE PEOPLE DID THOSE THINGS. I bet those gooks don’t hate the white man like they hate black people. I hope you gooks choke and die on your fucking chinese food!
Reply
Carlos says:
Sunday, October 18, 2009 at 10:34 am
They just have a very, very low self-esteem problem. If they didn’t why would they try to emulate Whites? As a Black man, I would never want to be White or Asian? If you were to ask most Whites are they proud to be White, they would say, “yes” Nothing wrong with loving yourself, but do you see Whites trying to broaden their noses, darken their hair black, change their eyes?? No and it would never happen. When you undergo these types of procedures it means you are not a confident person. Which most Chinese are not, just read through the blogs. So when Chinese do this, it makes them look really shallow, racist and no confidence whatsoever.
Reply
-1W says:
Tuesday, November 3, 2009 at 9:34 pm
“Black people didn’t enslave themselves.”
Yes they fcuking did. It wasn’t usually whites catching n selling Africans.
Who is making slaves today in China’s close pal, Sudan, is it whites?
Reply
+1African Warrior says:
Monday, October 19, 2009 at 3:30 am
you racist chinese people dont deserve to live on this planet
Reply
-1Hansolo says:
Saturday, October 24, 2009 at 7:17 pm
No, may be the Chinese deserve their own planet.
Reply
+2Luke says:
Tuesday, November 3, 2009 at 9:36 pm
In a galaxy far far away, hopefully!
Reply
mislin says:
Tuesday, October 20, 2009 at 12:16 am
This commentary is quite scary.
Reply
libertine says:
Tuesday, October 20, 2009 at 12:38 am
Wow, judging from all the racist comments here left by black people on this comment forum against the Chinese, we can safely say that Chinese aren’t the only racists around here.
Reply
+2Carlos says:
Tuesday, October 20, 2009 at 6:03 am
libertine, if you have half a brain, you would read that in my posts I am not being racist about anything as well as most Blacks. We are responding to racism, that’s the difference. If someone attacks me in an unjustified way, how should I respond? Just let it go? Avoid confrontation? This is totally absurd. If someone doesn’t like me because of my color, that’s there ignorant choice. But to slander me to mock or make fun of me or ridicule me because of it, that is an entirely different scenario. I will and should not stand for it. You can check almost any Black blog and you will never see the vitriol spewed that you see from the Chinese ones. That doesn’t there aren’t racist Blacks, but comparing it to the Chinese rant, its a very small percentage. Wise up!
Reply
+2libertine says:
Tuesday, October 20, 2009 at 7:36 am
You misunderstand me, sir. I didn’t say you, personally, were racist. But judging from some of the comments made here by some black people, one can also conclude that the feelings are mutual. Without a doubt Chinese racism is very real and exists against black people, but the opposite is also true.
“African Warrior says:
Monday, October 19, 2009 at 3:30 am
you racist chinese people dont deserve to live on this planet”
“Tommie Dynamite says:
Sunday, October 18, 2009 at 9:01 am
I hope you gooks choke and die on your fucking chinese food!”
AFRIKAN MAN says:
Sunday, October 18, 2009 at 12:46 am
Subconsciously, the asian man knows full well, that the Afrikan man is the superior man in every way. Why else would a person waste so much of his time spitting hatred about a particular race? “That which is most hated, is that which is most desired.”
“I guess you asian men should invest in some penis pumps, but that is only for immediate erection purposes only. Not for longevity!!! SORRY!!!! Well, since that is the case i recommnend you stick to what you know best: Shrimp Fried Rice and Miso Soup!!!!! And, i will admit that is some GOOD SHIT!!! THANK YOU ASIAN MAN!!!! YOUR THE BEST!!!!”
Smokey says:
Wednesday, October 7, 2009 at 3:06 am
We need to stop sucking jap and gook dick, and have pride in our nationals whoever they may be. And fuck you race traitor in HK and TW who think you are better than your brothers. If we cannot have unity we will all die. At least the blacks I’ve met in L.A. aren’t as cocky and smug as the assholes in the Valley. We need to start hating the right people, not those who don’t have much to do with us. Fuckin Spics are trying to drive us out our turf, whiteboys talking endless shit in the media and in secret, and we hate blacks!? Sure, there are some nigger bastards out there, but in reality the people who fuck with us the most are Japs, Gooks, island monkey traitor chinks, crackers, and Spics!!! But I digress, Fuck u all!!
BlackDonginHongKong says:
Wednesday, September 2, 2009 at 3:03 pm
Laugh at all the stupid racist Chinese blogging like crazy and all actually acting themselves like a bunch of monkey niggers. Fuck off you racist pigs. Chinese people are more like monkeys than black people are. Ooophhhh Ooophhh Ooppphhh just keep spitting on the street you gob-shite slit eyed chinky monkey niggers. The world was better off when China was closed. Now fuck off back into Communism you nasty fucks. You’ve got to be dumb and stupid to allow the Commies to rule you. Black cocks rule weeny yellow tiny Chinky penis anyday.
In any case, I think the point is clear. Nobody here is saying racism is good or acceptable. But when one wishes to battle monsters, he/she must take care not to become the same monster.
Sincerely, Libertine
Reply
+2Carlos says:
Tuesday, October 20, 2009 at 7:55 am
I agree. I think on the Black side being Black myself and living in Japan, being married to a Japanese and having a biracial child and knowing what racism is about I understand the anger that Blacks have in this situation. Because we are sick and tired and all we want is to be treated as people, that’s it. We are not looking for special treatment, just to be treated normally and when someone looks down at us, mocks us, belittles us, then we voice our opinion, some of them constructive, other times from the anger and emotions we have and Black people are really emotionally passionate, it can be ugly sounding and hateful. Are there Black racists, sure there are, but normally, usually not. But I do agree, with that last statement. You are right. But please try to understand our position too. This is 2009 it’s not 1935 we should have been over this racism a long time ago. I look at my daughter and I see the future, more importantly, the future of Asia! Whether Japan, Korea, China likes it or not, we are an emerging and international society and if these countries want to be team players in it, then they have to really understand. This is one wave that they can never stop!
Reply
Dad says:
Wednesday, October 21, 2009 at 12:05 am
If u are chinese
1) The girl is ur own blood! half chinese right?
Only a nazi population can refuse their own blood becouse is mixed. Congratz…
Reply
+2SISIY says:
Tuesday, October 20, 2009 at 5:27 am
In many ways, Lou Jing is a typical young woman from Shanghai. Pretty and confident, she speaks Mandarin heavily accented with the lilting tones of the Shanghai dialect and browses the malls of this huge city for the latest fashions.
But there is one thing that distinguishes this 20-year-old from her peers, something that has made her the unwitting focus of an intense public debate about what exactly it means to be Chinese: the color of her skin. Born to a Chinese mother and an African-American father whom she has never met, the theater student rocketed into the public consciousness last month when she took part in an American Idol–esque TV show, Go! Oriental Angel.
(See pictures of modern Shanghai.)
The marketing gurus for the series could hardly have dreamed of a better promotional gimmick when they started to investigate the backgrounds of the dozens of pop-star wannabes to root out the competitors’ mushy stories of triumph over adversity that are a well-worn staple of the genre. Here was a tale guaranteed to attract eyeballs: a girl of mixed race, brought up by a single Chinese mother, struggling to gain acceptance in a deeply conservative, some would say racist, society.
The strategy worked — perhaps too well. In August, Lou’s appearance on the show not only boosted viewer numbers but also sparked an intense nationwide debate about the essential meaning of being Chinese. Over the past month on Internet chat rooms, where modern China’s sensitive issues are thrashed out by netizens long before they reach the heavily censored mainstream media, Lou’s ethnicity has been the subject of a relentless barrage of criticism, some of it crudely racist. Many think she should not have been allowed to compete on a Chinese show, or at least not selected to represent Shanghai in the national competition. She doesn’t have fair skin, which is one of the most important factors for Chinese beauty. What’s more, her mother and her biological father were never married; morally, the argument goes, this kind of behavior shouldn’t be publicized, so she shouldn’t have been put on TV as a young “idol.”
These kinds of posts on the most popular chat rooms have attracted thousands of comments. A few have been supportive of Lou, but the rest range from expressions of fear and ignorance to outright racism. One of the most popular posts about Lou Jing on the KDS Life forum asked in mock seriousness, “Is it possible that she is Obama’s daughter?” Another poster said, “I can’t believe she’s so shameless that she would go on TV.” Most of the critics are agreed on one point: that this black woman cannot be regarded as a “real” Chinese.
As China undergoes an astonishing demographic shift and more foreigners make their homes in the Middle Kingdom, Lou is by no means the only one being treated differently. Recent decades have seen a surge in the number of mixed-race couples. According to the data offered by Shanghai Civil Affairs Bureau, from 1994 to 2008, each year there have been about 3,000 more mixed-race marriages in Shanghai. But as the children of that first generation of mixed-race marriages come of age, their moves to gain acceptance in society — like Lou’s participation in the TV show — have exposed a deep-running vein of xenophobia in Chinese society. Last year, Ding Hui, a young man of African-Chinese ethnicity, caused a stir when he was called up to the national volleyball team, prompting much soul-searching about whether the athlete should be allowed to represent China alongside pure-blooded Chinese competitors. Eventually, Ding Hui did go on to play for the national team.
“As China continues to open up, this kind of phenomenon will become ever more prevalent,” says David Zweig, a professor of humanities and social sciences at the Hong Kong University of Science and Technology. “This is part of the process of internationalization, but we can only hope that Chinese people, including netizens and the people whose views tend towards extremism, can come to accept that there are many mixed-race people, both in China and worldwide.”
As for Lou, she found the whole experience more than a little disturbing. She did well in the show, ranking in the top 30 contestants before she was eliminated. Now she’s back to her normal life as a college junior — with a little new insight into her home. “Through this competition, it’s really scary to find out how the color of my skin can cause such a big controversy.”
Reply
+2Bronze Breeze says:
Tuesday, October 20, 2009 at 8:48 am
I am African and male, I have read the comments on this site with interest, Firstly I think Lou Jing should hold her head up high, she is beautiful, much taller and sexier that anything that will ever come out of China at least for the next 10000 years. I think the chinese male should look at him self before he attempts to alter any comments against we Africans, African-americans, Afro-Caribbean etc. There is so much envy against us. Simply putting it We are simply the best! ….I do not want to go into this but if I am pushed your whole inferior life will disintegrate in front of you. Just look at our physic of the so called Black man, it is the desired physic!. If I happened to be a Chinese Woman there is no way I’ll consider having a Chinese man to father my children for obvious reasons. Let me say no more…however I suggest you turn and vent your anger / frustrations on the Japanese who 60 years ago treated you lots like sub-human animals and don’t have your fingers burnt by taking on us people of African decent. WORD OF WISDOM
Reply
+3anne says:
Tuesday, November 3, 2009 at 5:41 pm
I think she’s gorgeous too…but height wise…most northern Chinese girls are taller that her, by quite a bit. The Chinese are mostly ignorant racists as opposed to malicious racists, they don’t know any better. And as for the Chinese men’s racists comments… well, men are possessive, if a Chinese guy took your gorgeous black women through adultery, naturally you’d be pissed. In contrast, there are posts here when a Chinese men and a black women are in a relationship, and most the Chinese guys cheered them on. So, rather than having a bunch or racists chinese men, it’s really more a bunch of bitter Chinese men that can’t get any.
Reply
+5Bronze Breeze says:
Tuesday, October 20, 2009 at 9:07 am
Mr. F. King Knowitall wrote in his comments on this site “Keep blacks out of China” I think you’ve got it completely wrong mate!
It should be keep those Chinky-chinese-chimpanzees out of Africa!
They are arriving by Cargo Plane loads every hour!
Reply
-4Hansolo says:
Saturday, October 24, 2009 at 6:50 pm
I agree, keep those Chinky-chinese-chimpanzees out of Africa.
Africa for Africans.
The dump ass Chinese going over there and bring back so many black Africans to China for what, to make black babies, is so stupid.
China is for Chinese and never forget that.
Reply
Dine says:
Wednesday, October 21, 2009 at 3:35 pm
PEOPLE GET A WORK! ENOUGH COMMENTING!!! FIND SOMETHING TO DO. OMG! HE WHO HATES OTHER RACES BECAUSE OF SKIN COLOR OR SOME KINDA RACISM IDEALS IS A BIG FAGGOT! IF YOU DON’T LIKE SOMEONE BECAUSE THEY ARE CHINESE OR BLACK, THEN FACE YOUR LIFE AND GO FOR WHO YOU WANT. ITS A FREE WORLD. LEAVE PEOPLE ALONE TO DO THEIR INTERRATIAL OR WHATEVER. STOP PEEKING ON MISTAKES OF PEOPLE, YOU BETTER LEARN FROM MISTAKE AND SHUT THE HEAL UP!
Reply
-1Dad says:
Wednesday, October 21, 2009 at 7:12 pm
Out of Africa soon… remeber it!
Spread the sentence!
Out and bye bye!
Hope to see u no more…;-)
Reply
-1RAK says:
Thursday, October 22, 2009 at 10:52 am
It is precisely this “racial consciousness” or even “tribal instinct” that gives Chinese strength. In fact you sort of see the same with many Ashkenazi Jews (having interacted with them, and so many are physically indistinguishable from WASPs and *yet* they maintain their boundaries), as well as Koreans and Japanese, some East Europeans etc. I didn’t always recognize this and once upon a time I even thought this type of attitude was parochial. I have since changed my mind.
Now, this poor innocent Lou Jing wrote:
“1. My father is American, not African.
“2. I am a born and bred Shanghainese person.
“3. I should not have to bear my parents’ mistake, I am innocent!
“4. Sternly but strongly protest some people’s racism, my skin color should not become a target of attack!”
Comments on Lou Jing’s points above:
1. Blood is thicker than water, race/ethnicity trumps citizenship. Can anyone seriously think that a Mbuti pygmy or a Bushman is a true Swede just because he emigrated to or was born in Sweden?
2. Same as 1, biology trumps culture. As the saying goes just because you’re born in a manger doesn’t make you a bale of hay.
3. I actually partially agree with this at the individual and personal level – sort of like the case of Obama really – in his autobiography he confessed he never belonged and how his vacation to Europe was a nightmare as he couldn’t relate at all. (* See below) Yet in a way it’s really not Obama’s fault but the fault of his white slut mother’s.
Same in the case of Lou Jing.
(In fact, Lou Jing’s mother was lucky.
http://tinyurl.com/yjpjqge Side point.)
But make no mistake, she is no Chinese. No matter where she was born, no matter how she was bred, and I’m sorry to say, no matter how hard she tries. Again, just because you’re born in a manger doesn’t make you a bale of hay.
And if she doesn’t like it in China, she can always leave.
4. It’s not skin color per se; it’s ancestry. If it were skin color, a Dane who suntans would become an Hispanic, and anyone with 4th degree burns would become a negro.
* * *
OK, some of you will say I’m tough on Lou Jing on point (3). But let’s take another example. Let’s imagine that your girlfriend or wife is exactly the same in every single way – in looks, height, weight, body contour, personality, complexion, hair/eye color etc etc with the exception of one: turns out “she” actually is a tranny. That is, genetically “she” is an XY, but “she” has done all that she possibly could to be female, and in this case to try to please you – she wears dresses and makeup and has in all probability just undergone a US $50,000 radical plastic reconstruction surgery procedure to be a female. How many of you, in between your ears and in between your legs, will *still* take her as your date or gf or bride?
—-
(*)Quoted from Sailer’s Half-Blooded Prince:
“Similarly, around Obama’s 27th birthday in 1988, between his three years as a racial activist in Chicago and his three years at Harvard Law School, he traveled to his father’s Kenya for the first time. On his way to Africa, he spent three weeks touring Europe. But his racial resentments made his European vacation a nightmare. He found sightseeing amidst the beautiful ancestral monuments of the white race to be wounding to his racial team pride:
“”And by the end of the first week or so, I realized that I’d made a mistake. It wasn’t that Europe wasn’t beautiful; everything was just as I’d imagined it. It just wasn’t mine. [pp. 301-302]“”
Sailer continued:
“Obama in Europe was like a Boston Red Sox fan in Yankee Stadium in New York. Sure, the House that Ruth Built was magnificently large and echoing with glorious baseball history, but that just makes it more hateful to a Red Sox rooter.
“”In Europe, I felt as if I were living out someone else’s romance; the incompleteness of my own history stood between me and the sites I saw like a hard pane of glass. I began to suspect that my European stop was just one more means of delay, one more attempt to avoid coming to terms with the Old Man. Stripped of language, stripped of work and routine, stripped even of the racial obsessions to which I’d become so accustomed and which I had taken (perversely) as a sign of my own maturation? I had been forced to look inside myself and had found only a great emptiness there. {pp. 301-302]”"
Reply
Dine says:
Thursday, October 22, 2009 at 8:19 pm
RAK! what are you writing? rubbish! stop peeking on mistakes and leading people backward. Just do what is good in your eye with your own life. Get the fuck out of here!
Reply
Carlos says:
Friday, October 23, 2009 at 5:44 am
Thank you for the Anthropology lesson, it was quite interesting, but to get to the chase, being a person of mixed race. I fit in quite fine as do most of my mixed friends, it just depends on who you talk to. My daughter is mixed and she as I did embrace both cultures. There is no harm in it. This has been going on for thousands of years and all the better. Is it for everyone, perhaps not, but to say it’s bad, utterly ludicrous! Lou jing IS Chinese, who cares if she is ethnically not 100% pure, totally irrelevant. China is so ethnically diverse, this is just a mild stepping stone for things yet to come. We make such a big deal of race and there are more serious problems in the world than just race. Case in point; Obama is biracial, but there are some people that are becoming more and more dissatisfied with him and his administration(count me in)There are people that blame him, call him derogatory names, but they seem to forget that he’s half white, but are blaming and expressing that a black man is not intelligent to lead our great nation, but if everything starts to take an up tick and the jobs are coming in, healthcare is finally resolved etc.
What will these same bigots say about Obama then? They now love his “White”side for fixing all of US problems. Racism can also be selective. No race is as diversified as the Latin culture. Is there racism in the Latin culture, of course there is, you will have your occasional bigots, but by in large, if you want to talk about a group of people that have made it. I think Lou is a beautiful Chinese girl and I wish nothing but success for her and pray that she raises above this.
Reply
-1RAK says:
Sunday, October 25, 2009 at 3:14 pm
http://tinyurl.com/7wno46
Reply
-3RAK says:
Monday, October 26, 2009 at 3:53 pm
And incidentally in my reply above look at our human phylogeny:
http://tinyurl.com/yjskev7
That is, not all mixed-race unions are equal. Blacks are clearly clearly clearly an outgroup vs the rest, consistent with the much touted out-of-africa hypothesis, just as chimpanzees are an outgroup to humans.
And therein lies the issue when people think no one is pure and we’ll therefore all be happily blended in for some cafe-au-lait treatment and then we’ll all be holding hands under the sun singing kumbaya. Nope. Mixed unions are not equal. A black-indian union is very different from a French-Japanese union for instance. And besides homogenization does not occur at equal rates and does not occur equally and symmetrically between all groups so differences will remain for a very very long time.
Even outside social context, mixed race people are *still* at a concrete distinct disadvantage in this case, bone marrow transplant for example:
http://tinyurl.com/yjctxpe
Mixed ancestry, if anything, is a handicap.
Reply
Charles Liu says:
Thursday, October 22, 2009 at 4:46 pm
(Just to be clear, I’m American, not from Mainland China, ain’t never been citizen of the PRC a day in my life.)
Why do I find your cherry picked “bridge blogging” unconvincing? When I looked on Baidu using Lou Jing’s name, great majority of the opinions in Chinese blogsphere is not racist, supportive of Lou Jing.
Here are few common *positive* opinions you seem to have categorically neglected:
“洪晃:我们凭什么歧视混血女孩娄婧” – “Hong Guan: what right do we have to discriminate against mixed blood girl Lou Jin”
“娄婧没有错,对娄母也应多宽容” – “Lou Jing is blameless, her mother deserves understanding too”
“看中国男人怎对娄婧母女发邪火” – “observing Chinese male-chovanism againt Lou mother-daughter”
“娄婧的呼声感人肺腑” – “Lou Jing’s appeal [to find father] moved me to the core”
“娄婧天使舞台证明自己和大家一样” – “Lou Jing’s stage presence proves she is the same as everyone”
“并不是因为她有着奥斯卡影后上海“哈利贝瑞”的称号。而是娄婧切身的故事” – “not because she resembles Halle Barry, but because of her life story”
Reply
+1Ha Ha says:
Saturday, October 24, 2009 at 4:03 am
Do not lie to us man! Chinese people dislike dark skin!
Maybe u do not see cctv anymore, by the way it’s all
“Become white”, “Use this cream” bla bla bla…
And with dark skin sometimes ur people is really strange and racist!
Do not say bullshit!
These fuck idiots watch ur fuckin’ country tv and really belive black are inferior!
Trust me… I know ur people better than u!
Hope for chinese all the best but they have to evolve!
By the way.. I m dark skin! ;-)
Reply
Charles Liu says:
Saturday, October 24, 2009 at 6:12 am
Skin lightening cream infomercial is on TV in America too, so what?
Reply
Ha Ha says:
Saturday, October 24, 2009 at 10:32 pm
R u saying us chinese like dark skin?
Funny! Are u still a chinese?
Reply
+1chris says:
Saturday, October 24, 2009 at 11:03 pm
I am a black guy…I have another for you HA HA, the truth..here is her phone number 6262367192 her name is ahn and I met her at her husbands motorcycle shop… I took my Kawi there regularly and he would leave her at the shop often. I started talking to her when he worked on my bike. I asked her to lunch sometime and she said ok. I found out where they lived and knocked on the door. She opened the door and I went in. Her apt was filthy and she looked tired and beat up. She said she was going to clean up, I knew she was just dirty. She said she slept in another room with her son, and her hubby slept on the sofa. I asked if he ever comes home for anything, she said no. I knew she was in need right then.I rubbed her ass lightly when she passed by me..she new she was getting exactly what she hoped for. I ran out of time, so I gave her my address. I didnt think she would show but she did. I put her legs on my shoulders and pushed it in all the way..she came and drooled all over her face. I came so hard inside her she pissed on herself.
+1chris says:
Sunday, October 25, 2009 at 8:09 am
No ha-ha…it’s not the skin. It’s like forbidden fruit, the intensity, the sneaking around, my complete concentration on getting in as deep as physics will allow,watching her face distort lost in pleasure, knowing she doesn’t care for me (good), keeps my objective clear..next one that comes along is in for something different. I am a light-skinned black man with my own perspective of racism…It really isn’t about race…It is about class….which, if you think about it, exposes the other obvious factor>>>>>>>>> >>>>>MONEY.
+1W says:
Tuesday, November 3, 2009 at 9:20 pm
Only for strange Asian girls not wanting tans or for people wit skin spots
Reply
-4Hansolo says:
Sunday, October 25, 2009 at 7:11 am
“Hope for chinese all the best but they have to evolve!”
Evolve in to what?
Into a black race like yours in Africa or into a white race like all the westerners here want us to be?
NO thanks, if we want to change color we need only to put paint on.
———————-
And as for chris, as for a black guy, you are very slow to screw a Chinese woman. They are pretty easy for white guys and for black men it should be just a snap of your fingers and she will be on her knees and eating you up like a candy bar.
Too slow dude, got to chop-chop in China if you want the best and fresh ones or you will end up like us Chinese guys getting the used virgins.
Or worst, you may get some Chinese guy’s ugly used wife like Lou Jing’s mom.
Reply
+1blackchina says:
Saturday, October 24, 2009 at 2:09 am
Lou Jing is the most beautiful woman God has ever created.She is a natural beauty and looks like a model.I see no colour when i look at human beings.All i see is people.You maybe pink or brown but you are still a human being.I care about the inner person.Alson when it comes to women like Lou Jing ,she has got a rich flavour.I salute whoever isgoing to marry this Goddess.May GOD/BUDAH/ALAH THE CREATER BE WITH HER ALL THE AYS OF HER LIFE.
Reply
Charles Liu says:
Saturday, October 24, 2009 at 2:22 am
bc, most Chinese netters agree with you, contrary to what OP’s cherry picked comments insinuate.
Here are some more positive/supportive quotes from Chinese blogshphere:
“勿以肤色论英雄” – Shouldn’t judge by skin color
”“黑珍珠”娄婧证明自我” – “black pearl” Lou Jing proves self-worth
“娄婧比模特儿更美” – Lou Jing is more beautiful than models
“大家多谅解她吧” – people should cut her some slack
“娄婧是个小天使,这与她的肤色无关” – Lou Jing is an angel, matters not what skin color
“黑色只是普通的肤色” – Black is but a normal skin color
Reply
+2Matthew says:
Saturday, October 24, 2009 at 5:55 am
I am also chinese, a southeast asian with a olive skin. When I was in china, I was asked to leave the department because my skin is darker than the lighter skin chinese. I was very angry too. But what can I do. In China, lighter skin is considered beautiful and superior. I cant even get a chinese girl although I have a large weapon. They prefer a lighter skin man or they will feel ashamed.
Now I dont chase chinese girl anymore. Instead, I chase my own race or race which are friendier.
Lou Jing is darker than me and I feel that she will have difficulty time living in china. Thats is the truth. I am a Chinese living in Europe for a long time.
Reply
-1Ha Ha says:
Saturday, October 24, 2009 at 11:22 pm
What the hell is that?
Live the department? Reason = dark skin same contry!
Reply
-2Hansolo says:
Sunday, October 25, 2009 at 6:41 am
Well what a shame but you are not alone in this, I was in China not long ago and I couldn’t get to lay a Chinese girl neither.
Not even in the west can I get to do a Chinese girl, for the matter not a white woman nor a western girl.
You know what our problem is?
We are NOT Black enough you and me. Or may be the wrong skin color.
I know about the wrong skin color, back in my college days when I called for a job interview I gave them my Chinese name and they said no jobs. That same day I called again and gave them my western name, I got an interview but I didn’t get the job when they saw my yellow face walking in to the office. And this is in Canda not in China. So don’t feel bad, just get darker.
Reply
-10Pusan Plaza says:
Saturday, October 24, 2009 at 10:14 am
She is black. Now that says it all. Black devil with a whote to a mother. Should she be discriminated against? Yes!
Reply
+2Carlos says:
Saturday, October 24, 2009 at 2:17 pm
Really? Why Mr. Genius? If you are so smart and intelligent to make a comment like that, back it up. Why do you think so?
Reply
trunks says:
Thursday, November 5, 2009 at 2:41 pm
well im african american should i cancel my plans to visit korea since you seem to hate black people, should i not listen to ss501 either. i mean i really would hate to think that your country would be fun to visit if that’s what it’s people think. so i guess you don’t like crystal kay either.
Reply
+3Max says:
Sunday, October 25, 2009 at 12:22 am
Ah… Methinks it’s just about exposure to multiculturalism. Where I grew up in western China people were quite used to having people of different ethnic backgrounds around and would have reacted more naturally than the Shanghainese. I do have lots of Shanghai friends and I think while most of them are nice, their problem is their mind is just preoccupied by some hierarchical ideas.
Loujing is beautiful – as a Chinese guy I can appreciate her beauty. She’s innocent and I think people shouldn’t pick on her. That said, having a wife that cheats still sucks for many people. This is not a judgment about Lou’s mother’s characters but a mere fact about how people in China would think.
I think the reason why the KDS gang reacted the way they did was partly that they think it’s outrageously funny because “if you cheat at least don’t be dumb enough to risk making it way too obvious”.
That said, I can’t deny that there are still quite some racist elements in those comments, just like in the comments here.
And just to clarify again, China is not a race, it’s just a country where different people live. I for one wouldn’t fit most people’s stereotypes of how a Chinese should be. Ignorance breeds racism, and it’s so not cool.
Reply
-1Hansolo says:
Sunday, October 25, 2009 at 5:12 am
Now how can China be a racist country when it is not a immigrant country like that of the US or Canada?
Yeah the US and Canada are countries built on the backs of slaves, immigrants and they are made up of mostly foreigners, China is not the same.
China is seen to be and deserves to be called racist because they allowed too many blacks and whites into the country. Now they have a race problem like in most western countries.
What a fucked up world this is, blacks and whites hating the Chinese but fucking the Chinese women at the same time and living there like kings there. And they won’t let me go back and share in the fun in China but I am here stuck in this shit hole of a country and the blacks are in my motherland fucking everything up.
Reply
Carlos says:
Monday, October 26, 2009 at 9:03 pm
For the last 8 years, Whites were fucking the US up for a long time, can’t generalize a whole group, remember that.
Reply
-3Hansolo says:
Sunday, October 25, 2009 at 5:55 am
This black girl is fine with me, she is what she is, you can’t pick your parents.
Racism is a part of human rights, it’s like eating what you like or not like to eat.
Say I like curry foods but I dislike to eat many Indian dishes, does that mean that I hate all Indian foods. No.
Not long ago I was in the Caribbs eating all kinds of Caribbean cooking but I stop eating it in St. Thomas because the food there sucked. Some people there didn’t like it neither so we all walked away. On the beach a black woman from the island asked me, you don’t like sea food or is it you just don’t like black food?
That was a loaded question, what was she asking really?
Reply
-4chris says:
Sunday, October 25, 2009 at 7:35 am
Hansolo….what’s up? I think it’s sick how chinese women settle with these old, goofy, non-virtuous white freaks. I respect the asian women that keep thier culture intact. I have a bud from laos who can’t get much action because his skin is a little darker. The ladies I mentioned had white hubbys…so I made sure it wouldn’t be the same. If I see a nice asian woman with her asian other half, I just glance (out of respect) and give them plenty of room to pass. It seems like the chinese ladies with white men are very willing underneath it all.
Reply
-4Hansolo says:
Sunday, October 25, 2009 at 8:24 am
In a funny way you are right.
Yeah I see these same Chinese women here every day in Canada, many of them showing off their rejects or welfare mates like they won some kind of a dog prize or something nobody has.
Some good looking Chinese women have bad taste for white men, they got the old, sick and darn ugly whiteys for a partner. How sick is that?
I was telling you if you want to do these Chinese women better do it fast or somebody will beat you to them and you’ll get seconds like us Chinese guys.
There’s a few non-Chinese male friends I know that gets to do 2 or 3 Chinese women a week and some are Chinese housewives or working girls. Easy pickings if you are the right color, not for me too bad so sad.
Reply
Ha Ha says:
Monday, October 26, 2009 at 10:05 pm
Ok Hansolo! If u want to be the wrong colour for the 60% of world population (now) and soon 70%, ok… as u like my friend!
Mussolini said “A lot of enemies a great honour”.
Do u remember how he ended? ;-)
Reply
RYAN from Queens NYC says:
Thursday, October 29, 2009 at 8:58 am
This is pretty incredible. Even though people may not have been exposed to other cultures (Black, asian, white etc…..) it’s good that people talk about it and discuss these issues, because if you’re confronted with the issue first on the street, it may erupt, or earthquake right in everybody’s face!!
I’m a black man, of Jamaican heritage, and I believe Blacks, Asians, Whites Indians are beautiful and have SOME QUALITY that is strong and abmirable. not everybody thinks this, and everyone is entitled to this thought. personally, i wouldn’t be mad to see an Asian going out with a black girl. In fact, If I se ANY GUY even sitting or standing next to a fine chick and she’s breathing hard like her heart’s beating heavy, and he’s an ok person? I’ll tell him stop being a bitch nad BAG THAT BITCH!!!
-One Luv-
Reply
+2Valen says:
Friday, October 30, 2009 at 2:48 pm
Errr….I was with you until you just objectified half the human race. Check yourself please.
Reply
+3Sheena says:
Saturday, October 31, 2009 at 3:42 am
I think she is beautiful, and it is shameful of china to think of her that way. And they have the nerve to call America barbaric. I see it all the time chinese women bleaching their skin and fixing their eyes. You can tell they are inscure about themselves.I think Lou Jing is beautiful milk chocolate beauty and people are just jealous of that!
Reply
-2marco says:
Sunday, November 1, 2009 at 1:30 am
That women was only interested in black snake, now the poor daughter pays the consequences all life long: not chinese, nor black…
Reply
+2Andy says:
Sunday, November 1, 2009 at 10:26 am
Some of these comments are stupid.
Stop this racism. No excuse for poor English.
Reply
+1Andy says:
Sunday, November 1, 2009 at 10:37 am
But I feel the stories like from ‘the guardian’ are probably selective on negative comments.
Chinese people loved ‘Usain Bolt’ he was the hero of the Olympics. Lets not oversimplify this.
Reply
+4Choco says:
Sunday, November 1, 2009 at 2:46 pm
I’ll just put this out there: I skipped all the bullshit Chinglish above me, because it’s just not worth my time.
On topic: to the haters trying to spread some racist bile on here, first of all, get a dictionary, and then most importantly, GET A LIFE.
This girl is beautiful and as she said in her own words, innocent of any wrong-doings that her parents made before she was even born.
The world is only so big, people. And guess what? China’s been open for how many years now? Every skin color now is allowed to live with you, eat with you, and wait for it….marry and have sex with you! Welcome to the 21st Century!
Oh and let’s not forgot the president of the most powerful country in the world is also a beautiful blend of cultures.
Any hatred on here regarding skin color, nationalities, or whatever else is just stupid and pathetic. Get off the internet and try making some real life friends, and maybe your English will actually improve.
Oh, and 别用中文骂我,因为我会讲中文!!!^__^
Reply
+3James says:
Sunday, November 1, 2009 at 5:48 pm
Wow, I’ll remember all these racist comments the next time a Chinese person complains that Western people are racist.
Compared to Chinese, Western people are angels.
Shame on you, Chinese people. What a terrible way to behave.
Reply
MingMing says:
Monday, November 2, 2009 at 6:29 am
I can’t take any comment on this topic seriously because they all sound the same.
Reply
+7Proud Sudanese says:
Monday, November 2, 2009 at 7:01 am
God! Most of the people posting here are FUCKING RACISTS! That’s right! I said FUCKING RACISTS! Get out of your comatose bubble and over your superiority complex. Lou Jing is damn fine and talented! The next time some racist calls you “Chinaman”, “Cunt-eyed”, “Chingchong” or “Chink”, don’t get angry and whine about being subjected to racism coz you probably got a good dose of your own medicine. And oh..BLACK IS BEAUTIFUL! Suck on that!
P.S. Get out of Tibet, Uyghurstan.
Reply
+4Bronze Breeze says:
Monday, November 2, 2009 at 9:54 am
But really I am quite shocked by the attitudes to these Chinese. ..Nevertheless if they want to think this way, they must be prepared to receive their own medicine in much greater measures. We Africans or African descents are very proud people, those who have taken on us in the past will tell you of that and our resilience. So please don’t waste your time you’ll only come off worse.
Reply
+2trauko says:
Monday, November 2, 2009 at 12:30 pm
Incredible, China is desperately trying to be accepted as a modern potency, yet they are still submerged in their primitive past… you really think that being “modern” and “civilized” equals being ignorant and racist? The pathetic and illiterate comments put here demonstrate that China has a long way to go before it really becomes part of the 21st century. When you stop murdering your new born girls, stop the endemic corruption in your country, gain some freedom of speech and some social enlightment about race, then maybe you will be accepted as equals in the modern world, until then you will be considered just “the new rich” with no real understanding of the modern world. Remember that the biggest kid in the playground may be the most powerful, but often the least intelligent. Grow up China, and open your eyes, this girl is beautiful.
Reply
+4Bronze Breeze says:
Tuesday, November 3, 2009 at 2:56 am
So this forum of retarded Chinks is still going. Yes a chink will always be a chink
It is fitting to say they personify the word chink which of cause is a weak point in someone’s character, arguments, or ideas, making them vulnerable to attack or criticism
Reply
-9Stormfront Aryan says:
Tuesday, November 3, 2009 at 7:34 am
Oh lawdie, I love how negroes play the racism/victim card so damn much and act like they’re these innocent little angels who are oppressed so damn much by the big bad whitey or, in this case, the big bad chinaman.
For a people who supposedly care about racial “equality,” and condemning racism so much, you simians are pretty quick to dish out some downright xenophobic racism yourself. If it’s not Whitey oppressing you, it’s the Asians, Mexicans, or anybody else you can get your hands on.
I feel so damn sorry for Japan, Korea, China, and all the other East Asian countries in the future. Once we Europeans go extinct, you monkeys will be on the Eastern continent doing what you did best in white countries… robbing, raping, murdering, and being a pestilence to your host population. All the while expecting Asians to lift you out of poverty and give you free affirmative action, food, money, and plenty of “HOT ASIAN WIMMIN, DAWG!”
The future does not look good right now.
Reply
+2GGooDeiMC says:
Tuesday, November 3, 2009 at 8:18 am
LOL
You actually came to Asian website to spew racism. Then have the nerve to have Aryan at the end of your name. Then you want to talk about how all other races are ANIMALS when you the CAUCAZOID. Pale meat. Pink face. HONKEY. Cracker Barrel race are the main reason for racism. I love internet racist. They can only bust a nut by posting dumb ass comments on websites. And trust me IDIOT you would never I say never say this in public.
Reply
+5250 says:
Tuesday, November 3, 2009 at 8:29 am
Don’t you people (by ‘you people’ I mean the majority of people who have left posts on this page replying to racist comments, let’s just be clear about that) get it. You cannot criticize racism while spewing your own racist comments. It’s like telling a child not to eat dog shit while you pick a steaming pile off the floor and cram it in your mouth. Am i the only sane person in this mad world?
Reply
-10Stormfront Aryan says:
Tuesday, November 3, 2009 at 8:34 am
Don’t get me wrong. I definitely prefer my own people over Asians. But overall, I’d still hold Japanese and Chinese above blacks anyday. I almost sympathize with their plight because of these negroes coming over to their countries. I got a friend in Japan who’s told me some pretty bad stories about how Nigerians come over, impregnate Japanese girls, then get their visas to stay in the country and sell drugs.
You people spread AIDS, violence, drug trafficking, and crime wherever you go. Just look up the FBI crime statistics for blacks in America alone. You guys commit fifty percent of all violent crimes and robberies and 35 percent of all rapes(Latinos are still competing with you guys in this department).
I originally thought the East Asians were smart enough not to embrace this multiculturalist bullshit but I thought wrong. Oh well, soon all of China, Korea, and Japan will find out how big of a disease blacks really are.
Reply
+7Bronze Breeze says:
Friday, November 6, 2009 at 6:55 am
Stormfront Aryan you are the typical European megalomaniac, nothing wrong to prefer your own people over Asians, but you can be rest assured that your own so called white women would not necessarily agree with you. I am African living in the UK for over 20yrs. Now it matters little whether you agree with the point I am about to stress: Your European women literally throws themselves at the foot of us so called black me, they love it, and it’s not just for the fact that we aren’t no BUGf**kers, we are real and complete men. You have a problem with our race because we are the only one so far that can kick your pale reddish-pink ass. As for your type dating our bronze skin women, ha! a sister once remarked: ” I understand having pink dolls, however the thought of having a pinkish colored man on top of me is a revulsion” You idiots aren’t proud of the colour God made you as, sometimes you are more reddish than pink and at other times you are more pinkish than red yet you claiming to be white! You do not even know your own true colour yet you attempt to define the color of others. You stupid calls my bronze skin black, that doesn’t bother I am proud of my skin colour any day! it reminds me of nourishment, of fertility, of the richness of the rich soil, of agility and strenght…….Oh yes! all the qualities you lack!….Yes the strong bronze man…Whilst you are blinded with envy and refuse to see us for what we truly are, your women comes alive with excitement even when they spot us from the distance. I’d still hold Japanese and Chinese above blacks anyday. I almost sympathize with their plight because of these negroes coming over to their countries. You claim to have a friend in Japan who’s told you some pretty bad stories about how Nigerians come over, impregnate Japanese girls, then get their visas to stay in the country and sell drugs…..He he he here you come again…Blaming others for your problems….why not your people stop consuming 90% of the worlds hard drugs production…..that will solve your drug problems. By the way that Japanese friend of yours….he/she’s not by any chance from Hiroshima or Nagasaki or suffering from the effect of radioactive fallout?
You claim we spread AIDS, violence, drug trafficking, and crime wherever you go… Really? be informed little hitler the generic term for most of these diseases in Africa is called the ‘White man’ diseases, this is because you name it from Syphilis to Gonorrhea, Small pox to WhatNot pox they brought it to the Continent. Their terrible tragedy made our people not immune against these strange diseases die like flies. Read some books this is recorded history. You say black men commit fifty percent of all violent crimes and robberies and 35 percent of all rapes..Just what planet have you retard flew in from? When a rape or a gruesome murder is carried out in your country (And I’m aware you are American) the profile the law enforcment agensies firt put out is that of a psychopathic white male. The study of the psychopath reveals an individual who is incapable of feeling guilt, remorse or empathy for their actions. They are generally cunning, manipulative and know the difference between right and wrong but dismiss it as applying to them.
They are often the serial killers/rapist, incapable of normal emotions. Generally, they react without considering the consequences of their actions and of course just as we have witnessed in your case, they show extreme egocentric and narcissistic behavior.
You stated that you originally thought the East Asians were smart enough not to embrace such multiculturalist bullshit but that you were wrong. Oh well, soon all of China, Korea, and Japan will find out how big of a curse you and your race have been to Humanity and not us people of African descent. We Africans did not start the wars that wiped out virtually all but a hand few of the thousands of European tribes through sheer barbarity on a scale never seen before and never shall be seen again. Africans did not start nor contributed in any way to the 100 year of barbarities between France and England in the name of the ‘crown’, we did not ship over 100 million of our African people to the west into a life of slavery, we did not annihilate the entire population of the ‘red’ Indians from the Americas and the Caribbean, we did not completely wipe out the wildlife in that part of the world, neither did we inflict tears, sorrows and death upon most of the worlds population in our quest to conquer, subjugate and annihilate the indigenes, thus seizing their lands and resources solely driven by greed and the savage thirst for blood. The blood of the Aboriginals of Australia still cries out to God for mercy out of a desire to relieve the sufferings of their past, present and future. Oh the over six million Jews burnt in the death camps of your European civilization, the over 50 million death on Europe’s war theaters of the European war (So called world war II), the tens of million who perished less than twenty years before in Europe’s World War I, Africans or the people of African descent had no contributions to all those. Ah ah! The Rape of Nanking, the Frying Hiroshima and Nagasaki, the crisis in Palestine, the wars of French and American Vietnam, the Korea wars, the Cold war and the amassing of weapons for mutually assured destruction not one of these despicable atrocities can be attributed to our people. Let’s take a look at recent history, the military attacks against Syria, Iran, Grenada, Libya, the Sudan, Iraq and the list goes on and on, these are not the handy work of Africans or Africa’s descent. So Stormfront your views are morally reprehensible; they are vile and only fit for the consumption of empty headed just like yourself.
Reply
+3Majiri Otobo says:
Tuesday, November 3, 2009 at 8:30 am
This site is full of ignorant idiots. And to storm whatever your generalisation of the black race is completely senile and thank God I know many asians who are not like you. As an African girl all I can say is racism in general comes from ignorance and fear. I don’t see why it is anybody’s business who marries who, where they come from and I don’t see why some Asian person should talk about my history. I hope your philosophy of what us ‘monkeys’ do affects you alone.
To all you small minded people, every race has people like you and thankfully people not like you. When you die I hope for your sake the colour of your skin is so ’special’ that you really get that extra treatment God made for ‘your lot if not you will rot for your stupidity. To any interracial couples, black people living in Asia, foreigners, interracial people hold your head high and work harder to achieve your full potential. The more of us that show how stupid racist people are the better for this world in general.
This is all so stupid cause Lou Jing is actually beautiful. stupid stupid people.
Reply
capt. LING DAN WANG BA says:
Tuesday, November 3, 2009 at 8:57 am
DUDE, he is not ASIAN. Look up Aryan and visit sTormfront[dot]com
Reply
-1Carlos says:
Tuesday, November 3, 2009 at 10:20 am
It never ceases to amaze me how you backward moonbats try to rationalize everything by always invoking the White issue. Let’s not start talking all the atrocities that Whites have….uhm, excuse me, still commit on a daily basis.
I think you’re just jealous because your lost pathetic Aryan Butt either deep down inside yearns for an Asian girl or you just want to be a nuisance or a thorn to justify your lost cause, like anyone really cares about some insignificant White power guy, this conversation doesn’t involve you, go to the “Amren” site. Your childish comments will be much appreciated there and you can also wallow and talk about how the Jews, Blacks and Mexicans are taking over the world. Nice Try!
I think the future looks even worse for you, especially in the states Amigo. YOU ARE THE MINORITY. Better get used to it. Ask Tom Metzger, he can tell you all about it.
Reply
-7Stormfront Aryan says:
Tuesday, November 3, 2009 at 1:12 pm
Sorry to disappoint you monkey-boy, but I’ve never touched an Asian girl before and I don’t want to. I’ve met some East Asians before and they’re overall a decent, hardworking people who don’t demand affirmative action and other special privileges like you simians do. That being said, while I hold white civilization above Asian culture anyday, I still respect East Asian culture, especially that of Japan’s, far more than I will your third world baboon culture anyday.
I just thought I’d post this here to warn all the yellow Asians of the threat they face from savages like you.
And it’s funny you should mention Amren. Good site, really. Eloquent, well-researched, and well-spoken… the same of which cannot be said of you or any of your negro bretheren. But anyways, I’m going to stop posting here now since I’ve got better things to do. Arguing with blacks will lower your IQ by quite a few points so I want to save my brain cells while I still can.
PEACE OUT MY BROTHA!!!
Reply
+2250 says:
Tuesday, November 3, 2009 at 1:16 pm
yeah you better save that one braincell quick…..oh too late.
Reply
-1Carlos says:
Tuesday, November 3, 2009 at 3:41 pm
I see, so only in your mindless, idiotic Aryan Eyes Blacks spread AIDS? This is quite entertaining. Of course, Whites never get AIDS, nor do they spread them around either intentionally or not. I do have to say,it is quite amazing about your BS stats, so I guess one could say, that ALL of the High crimes or if you prefer “white collar” crimes(Bet you love that sound)are committed by Whites, overwhelmingly and might I just add that the last eight years of the mess that brought the US to where it is was done by Conservative Whites. Wasn’t Bush white or let me guess, he was a Jew, huh?
What’s Obama? He’s half White-Black, so I guess, the White side of him is screwing up America a continuation of the last eight years or blame the Black side and think like you do in that sorry, illogical brain of yours that the Black man can’t do anything, so which is it, “Pardner?”
I live in Japan and I can tell you stories also of US military White men that have done the same, knocking girls up and taking the high road, so it isn’t anything new. Maybe it’s something deeper. Maybe, you want to taste some of the forbidden fruit and you really want do get a Black or Hispanic woman, at least they have something that a lot of White women sadly don’t have and that’s an ass. We all have to live together and if we all want to make it in the next century, multiculturalism is the only way, like it or not.
You obviously don’t like it, so please do us all a favor like you said, just go and you can rave all you want, you are nothing, you know nothing about me, I will put my wits and match it with your dimwit IQ anyday of the week, but why should I? It just be a waste of time. Anyway, your post has been noted and with the utmost care rejected, ridiculed and laughed at! So go back to that hole Iowa whatever crevice you oozed out from, blog on Mark Furhman’s website and live a peaceful miserable, hateful, racist, solitude life wiz your Aryan Brothaz! Ta, ta!
Reply
+3Bronze Breeze says:
Tuesday, November 3, 2009 at 8:34 pm
Stormfront Aryan claims to have an IQ he-he-he-he. What an orangutan! You call people monkeys and Baboons, take a good look at yourselves, shave a monkey, shave a Baboon, shave a Chimpanzee or an Orangutan you’ll find out you share the same skin colour/tone. But not only that, you share the same fur covering your pale, pathetic, sickened skin. In-fact some of you are so furred up you are often mistaken for Yetis or BigFoot. Then your attitudes and vengeful fury easily describes you as animals. I am African, one thing I can assure you creature of, is that you do NOT have that faculty of reasoning and understanding objectively, especially with regard to abstract or academic matters in comparison with my nine year old. Simply putting it, you’ve got a brain made out of Chewing-gum.
Reply
-1capt. LING DAN WANG BA says:
Tuesday, November 3, 2009 at 8:13 am
SERIOUSLY. I GET HATED ON WHEN SO MANY HATERS IN THEW WORLD.
FUCK YOU ALL.
Reply
+1capt. LING DAN WANG BA says:
Tuesday, November 3, 2009 at 8:18 am
AND NOT TO MENTION IGNORANCE. IGNORANCE LEADS TO HATE. YOU FUCKS.
Reply
-2blackguy says:
Tuesday, November 3, 2009 at 8:49 am
All i can say is that Those who say negative things against that girl are just jealous.You can see her beauty.
I have been fucking small chiness girls here but i cant get that kind of colour. i will try hard to get that,Chines are yellow small little people except big Yaoming.But that doesn matter. They are still human and they help the world with fake things and powerful economy.they dont even have the body to do prostitution as a profession.but they are still likable and have pussy.hahahah
they are not white and not black, what are they? but still human. But am soo surprise that chiness people are also racist hahahha shing shong are racist hahahhah my God.No energy people are racist hahahah
we i respect all human being.but those who respect themselves being it white black or chinyellow.
Peace dude mother fuckerr hahah
Reply
-2capt. LING DAN WANG BA says:
Tuesday, November 3, 2009 at 8:53 am
Just because these kinds of ignorance and racism exists in China so now we should give the west free pass on the racism question. The west if free of racism now, thanks to racism in china. Great job!
Reply
capt. LING DAN WANG BA says:
Tuesday, November 3, 2009 at 8:59 am
See the idiots posting on this forum. 99% of the motherfuckers here makes no sense. Has no real knowledge but is complete ignorant.
Reply
Rasxcaljaxx says:
Tuesday, November 3, 2009 at 3:08 pm
You people are so so funny, in England people with non white skins are discriminated against, yellow skinned people are seen as no different than black, brown of mixed raced people by some white folk. people of differing races come together to stop this nazi view including white people. Your view are akin to the nazi’s so how do you defend yourselves in England when your people are abused, beaten and discriminated against when you are worse than the people in England. At least in the UK we have laws which would criminalize your racist actions. People in England now clearly see you are a terrible unjust and sickening nation. whilst sending 1000’s of ‘yellow’ workers to our country to spread your vile nazi views
Reply
+4Ras says:
Tuesday, November 3, 2009 at 4:55 pm
All I can say is fuck all of these racist Chinese people. you have the fucking nerve to come to Africa and look for minerals to develop your country but you cannot accept someone of African American descent to take part in a competition in your country. Doesn’t the fact that her mum is Chinese count. Oh Yellow babylon your days are numbered and your day will come. I only wish some of these African Leaders will have access to this kind of stupidity and kick your fucking asses out of Africa instead of giving land to thrive on.
Reply
Dazza Bea says:
Tuesday, November 3, 2009 at 11:57 pm
Well lets get in on this. Stormfront you are coward. What’s wrong did your mum take it up the arse from a Big Black man, or was it you. Or was the poor little White boy bullied at School.
I hope the chinese Govt takes action on this, as they already know, this will muck up relationships with the African countries they are doing business. Then again maybe not, some of the Africans are bloody greedy.
Also, I would never dream of coming on here and slag off somebody because of colour or because some of the Chinese are extremly racist.
Also for the record, Black/ Chinese mix has been around for years. Especially in Jamaica. Hence the term China Black They make truly beautiful babies.
Some of you must really live shelter lives.
Now for my US brothers. So easy to say, that Black US Fathers always leave kids, yet every nation has the same problem with absent Fathers. Black are not the worst. Fact.
I find negatives comments about the Black community on this site is beyond evil. You then wonder why Blacks are so aggresive. Come on, how many times can you kick me, enslave me, rape me and my land, brand me, lie about me, incasterate me and not expect me to react.
Stormfront your band of racism is not increasing, it is dying out, hence all of your crude remarks, looking for a rise in the Black community to slag off Whites and Chinese. Well Hitler lad, it not going to happen.
Obama is the Prez, A Black Man is the most powerful man in the world. (Fact)
Peace to all (Including Storm lad)
Reply
trunks says:
Thursday, November 5, 2009 at 3:02 pm
AMEN! they hate us cause they really love us and want to be us but they know they could never be that cool, never have that swagger cause they are just too soft!
Reply
+4trunks says:
Thursday, November 5, 2009 at 2:27 pm
it’s amazing to be african american and reading these jackass comments. it just really lets me know just how much the world hates us blacks. white folks really have all your heads fucked up! you want to be like them so bad but don’t you know they hate you too!you forget they made chinese people slaves in america too. i know people who are as dark as the darkest african and they are chinese too! where the hell do you all get off condeming a person just because of the way God made them. none of you are better than anyone else. stop letting white folks dictate to you what is beautiful and think for yourselves!
Reply
+3trunks says:
Thursday, November 5, 2009 at 2:49 pm
it’s really crazy how asian people think that the lighter their skin the better status they have. well im from california and most of the white folks i’ve seen and know HATE their skin so bad. the paler they are the more they hate it. there are so many tanning salons in southern california. they are also tanning at the beach and in their back yards. as an african american i cannot tell you how many people have come up to me and told me they wish they had skin and hair like mine. so don’t let those aryan type assholes tell you that you aren’t beautiful the way you are no matter where you come from. they are just angry and scared that they will soon be wiped off the face of the planet. thats why they promote preserving the white race, i don’t blame them for wanting to stay relevant but i denounce the bullshit that comes out of their mouths when they spread all this hate. being black, multiracial or whatever is not an illness. theres so much more to be arguing about in this world besides race. cause if these wars don’t there will be nothing of us left anyway.
Reply
-1red says:
Thursday, November 5, 2009 at 7:51 pm
These ugly chinese (all the same for me) relly belive they are number 1 and they are white? hehehe
Come on guys…
Education <–? u r all far away from it! ;-)
Reply
+3Grey Law says:
Thursday, November 5, 2009 at 9:37 pm
I am married to a Chinese woman, I am an American man of African descent. For the cerebrally challenged, this means I was born and raised in America but am a “black” man. I have travelled the world, I am very well educated and I have a home in China as well as America and Europe. I found that one of the largest extremes to me in cultures were Asians…typically Indian and Chinese. I found Chinese to be extremely racist and two faced, of course not all were, but those who didn’t appear as such were simply stoic; this being the cultural norm.
All in all, I still fell in love with a Chinese woman, married her and have a child with her. For all of you ignorant posters here, get educated, and channel that anger into good not bad, focus on helping your country out of its poverty and don’t focus on the lives of an innocent “beautiful” young woman. P.s. My advice to her, if she did have any legal remedy…would be to utilize it.
Reply
trauko says:
Friday, November 6, 2009 at 12:23 am
Incredible, China is desperately trying to be accepted as a modern potency, yet they are still submerged in their primitive past… you really think that being “modern” and “civilized” equals posting a few uneducated and dumb comments on a website and being ignorant and racist? The pathetic and illiterate comments put here demonstrate that China has a long way to go before it really becomes part of the 21st century. When you stop murdering your new born girls, stop the endemic corruption in your country, gain some freedom of speech and some social enlightment about race, then maybe you will be accepted as equals in the modern world, until then you will be considered just “the new rich” with no real understanding of the 21st century. I appreciate that not all chinese are racist as demonstrated by some of the more intelligent and enlightened comments here, but a vast section of your bethren need to be educated in the ways of the modern MULTICULTURAL world (and to those who hate: take a good look at your own country, its not exactly racially “pure”).Remember that the biggest kid in the playground may be the most powerful, but often the least intelligent.Grow up China, and open your eyes, this girl is beautiful.
Reply
Master C says:
Friday, November 6, 2009 at 2:40 am
The whole thing may have been orchestrated by certain hegemonist factions of the world, out to destroy Chinese society.
The netizens were not necessarily racist but they were responding (not correctly via abuse either) to the fact that her very existence is the result of cuckolding – and at this level of media attention – an insult to an entire nation.
If this was an unintentional occurance, then we should wish all 3 parties best of luck in life, AND remind them, along with the local and foreign media, not to play it up any further to avoid creating more offense.
For the sake of ‘World Peace’ let this fracas fade away and not be repeated.
Reply
+1Ken says:
Sunday, November 8, 2009 at 5:51 am
This girl should not feel shame, neither should her mother. The people commenting here should feel the shame. Who are any of you to cast your petty ignorant judgements upon Lou Jing? China is so far behind the rest of the world, it is so sad, i feel so much pity for all chinese who should say things like some of the people commenting here. PATHETIC.
Reply
-7Pradish says:
Sunday, November 8, 2009 at 7:36 am
Hahaha, niggers are a funny ape-like people who act like they’re so strong and brave when they abandon their children and kill each other in gang wars almost every day.
I am an Indian living in America and I have seen your behavior everyday. You dirty the streets and come into gas stations, threatening and harassing Indian, Arab, and Pakistani gas station owners. Who can blame the Chinese or anyone else hating you, hahaha.
Your young black thugs and welfare mothers with five children aside, even Gandhi himself, the international man of peace, hated blacks and thought of you as the dirty kaffirs you are. One of the finest men of our country correctly believed you to be inferior.
He had this to say.
Addressing a public meeting in Bombay on Sept. 26 1896:
“Ours is one continued struggle against degradation sought to be inflicted upon us by the European, who desire to degrade us to the level of the raw Kaffir, whose occupation is hunting and whose sole ambition is to collect a certain number of cattle to buy a wife with, and then pass his life in indolence and nakedness.”
And Gandhi, bless his heart, was correct. You niggers cannot carry out and create civilizations like we Indians have and it is funny to see you react with so much raw anger against anyone you think is racist.
Hahahahaha, go climb on a tree now, young ones. There is much you have to learn about peeling bananas!
OOK OOKA OOOOOK!
Reply
+3Carlos says:
Monday, November 9, 2009 at 2:05 am
Interesting an Indian man who is Black that wants to discriminate against another Black and who for strange reasons as many Black Indians that are suffering from shyness and and a very high inferiority complex wants to elevate himself by putting down another minority, hoping that he will be accepted in the White world. Nice try guy.
Why is it that so many Indian men try to bleach their dark skin and why is it that Indian men can almost never get a good looking chick?
I have so many ignorant losers as yourself that would constantly cry like a little whiny bitch that some brother gets all the girls and you don’t get squat. So because of this, the only thing you can do is try to put down another minority, although you are one yourself.
LMFAO!!
Let’s not even go there and talk about what a hell hole India is. I probably wouldn’t know where to start and then on top of it, it would take a century to write out all the things that are so overly fucked up with that cesspool country of yours. That is why you guys come to the states and get all the shitty 7-Eleven jobs, but I don’t blame you, if I had to work at a gas station and sell Slurpies all day, “Thank you very much, please come again” I’d be hating life too.
You built a civilization??? The Taj Mahal and? Stop boring people, please.
Funny, trying to Quote Ghandi, amazing. Indian twerps, such as yourself, always have some chip on their shoulder, wanting and hoping for the day to come that people will think that you are white and NOT black, but that day will never come, you will always be Asian and Black, better start to get used to it, my brother. Maybe if you stop eating all that fucking curry, take a bath and learn how to dress properly, you just might get noticed some day.
Reply
-6Pradish says:
Monday, November 9, 2009 at 8:55 am
Hahaha, my little black friend. By responding towards me with your own racist views and stereotypes against Indians, you have proven my point that negroes are whining infantile, racist hypocrites who care for no one else other themselves! Keep showing the world how lovely you are! I’m sure you will be rewarded for it beautifully one day.
And India is developing fine on its own thank you very much. We are not perfect but we are far superior to anything Africa has to offer! Our women far outrank yours in beauty and class. Your local black girl Shaniqua with her cellulite-filled booty and her fake gold chains cannot compete with even the poorest farm girl in India. Hahahahhaha.
You and your people are a plague upon the world and everyone knows it. Glory to India and death to the apes!
Reply
+2Carlos says:
Monday, November 9, 2009 at 10:01 am
First of all Haji, I’m not your friend and second, who said, I WAS racist? I was just responding to your idiotic rant. As well, you have these make believe stereotypes about Blacks, being one yourself…how ironic, something like a Negro with straight hair, but less the style and finesse.
Judging by your first post, it would seem that you were the one that was whining. We already have shown the world in Sports, Entertainment, business etc.
India is developing, yes, that is the word; developing, not perfect and definitely NOT superior, not by a long shot. Country? Well, to a point. People; don’t make me laugh! Your women outrank Black women??? Where? What are their names? What movies? World famous?? A-list movies, music?? Ahh, perhaps in that ultra-boring dance shit you guys call Bollywood, personally, it should be called “Boringwood or Shittywood” would fit the mold better.
Cellulite-filled. Hmmmm, funny, it seems like the only and I mean ONLY decent looking Indian women you see that doesn’t have a stomach big enough to have its own Zip code would be on TV/ Other than that, they slouch around with that lard oozing out of the sides. How attractive, so on that point, you might be right. Yea, Indian women outrank and outweigh Black women.
Again, your own inferiority complexes like you and many other Indian males that I have met are too funny. Get some style and you won’t have to worry about anything. Maybe you can get a decent woman and won’t need to have a constant temper tantrum. LMAO!
Glory to What? How about Glory to deodorant and how about India investing in some of that. Then you have the right to say glory.
Thanks, Black man!
Reply
-5Pradish says:
Monday, November 9, 2009 at 10:12 am
Hahaha, my oh my. Black people really are delusional little girls. By judging me in a negative and stereotypical manner based on my ethnicity and culture, YOU, my fine black friend, are ALSO being racist. I find this fascinating to a large degree that many of your people claim to be fighters for racial equality and crusaders against racism. But when the time comes for you to prove yourselves to be the nobel-laureates you claim to be, you act spitefully and viciously, behaving every bit like the racists which you claim to be fighting against. Your hypocrisy knows no bounds, my dear negro. Gandhi was right to have denounced your kind like the plague.
Keep on fighting the good fight for racial equalism and civil rights… the good fight for negroes being more equal than others and special rights for blacks only! Hahahahahaha.
+3Bronze Breeze says:
Monday, November 9, 2009 at 10:29 am
Pradish, you little PAKI jingoist, let me guess…… Yes! you are one of them horrid looking PAKI small creatures covered in thick, long, black, greasy, curly, prickly Ape like furs, from head to toes, disgusting. In the wild you’ll look no different from a Chimpanzee, in-fact you may even be hunted for bush-meat! Anyway who cares about your little indian comments? we never ever care about you that was why we threw all your furry PAKI asses out of Uganda back in the 1980s.
It’s about time you empty-headed do some basic learning………Poverty in India is widespread with the nation estimated to have a third of the world’s poor. According to the a 2005 World Bank estimate, 42% of India’s falls below the international poverty line of $1.25 a day (reduced from 60% in 1980). [1] While poverty rates in India are high, they are not on a par with what neighbouring Pakistan and Bangladesh experience. You call us little even though we dwarf you lots! Your women outranks as? with their flat asses, flat chested and only end up growing sideways? you are a fantasist a really dumb one. Your Gandi ran from poverty in your india to live in Africa remember, and your 1.2 billion people and still breeding like flies, crammed into a land mass the size of a medium size African country looks to me as a plague. Our beloved Africa is about 60 times the size of your sorry india yet our population is about 700 million, he-he-he-he Who are the real plague? …..According to the New York Times, it is estimated that about 42.5% of the children in India suffer from malnutrition in India. The World Bank, citing estimates made by the World Health Organization, states “that about 49 per cent of the world’s underweight children, 34 per cent of the world’s stunted children and 46 per cent of the world’s wasted children, live in India.”
A special commission to the Indian Supreme court has noted that the child malnutrition rate in India is twice as great as sub-Saharan Africa.
About African civilization Ancient Egypt was purely African! Ours transcends any thing that your frail hands can hold up in India.
Reply
-4Pradish says:
Monday, November 9, 2009 at 10:48 am
lol The nigger has learned how to do a google search. Bravo my intelligent young ape, bravo@
+2Bronze Breeze says:
Monday, November 9, 2009 at 10:57 am
If you meet a Cobra and a naked PAKI (aka little indian) at a crossroad what would you do?……hummm easy I’ll shoot dead the furry chimp first ….it is more bushmeat !
he-he-he-he
+3BleF says:
Monday, November 9, 2009 at 8:43 am
Wow, this girl is beautiful!!
No amount of slander, hate or prejudice can change this fact.
Racism I fear, is universal, however there are those amongst us who see past the stereotypes and take people at face value.
Reply
+2Carlos says:
Monday, November 9, 2009 at 10:39 am
Delusional you say? By judging you means exactly that, I am judging you and only you by your false statements and opinions. You keep referring to me, as racist. You know nothing about me of who and what I am, so in that sense, plain and simeple; you’re a moron.
Indian people and in particular, Indian men are the one’s that are over-the-top spiteful. What happened a few months back, falsely accusing Aussies of bashing Indians and being racist towards them in Cricket. First of all, no smart, intellectual idiot would play such a worthless sport, if you want to call it that. Watching the grass grow is far more interesting.
You are the one that is full of hypocrisy, saying one thing, but when someone else points out, your stupid rants, you want to dismiss it as facts. Too funny. Also, who cares what Ghandi says?! I mean, seriously in all honesty. The man is dead and he has no bearing on my life or most people except for Indians, so when you talk about him, you are just blowing hot air. No one cares, dude. Really.
Special rights, huh. Indians want all the rights for themselves wherever they go. I live in Japan and the Indians are so unfriendly to people here. Funny how my Japanese girlfriend and most of my Japanese friends always say to me how their English is so messed up. Only you guys can understand yourselves. Anyway, my Black friend, nice try.
Glad your writing this, probably, if you would talk to face to face, I would need a dictionary and a nose pin. LMFAO!!!
Reply
-4Pradish says:
Monday, November 9, 2009 at 10:50 am
At least we do not riot on the streets and assault innocents unlike you apes.
ps I would not talk to you face to face in real life. I would be in dire need of waste disposal to have to be around you for too long.
Reply
-5Pradish says:
Monday, November 9, 2009 at 10:51 am
In two seconds flat I would be throwing up from your ape stench. lol
Reply
Carlos says:
Monday, November 9, 2009 at 11:05 am
No, buddy. That stench is from your upper lip! I’d advise, ease up on the curry. LMAO!!
Reply
+1Carlos says:
Monday, November 9, 2009 at 11:08 am
Then you must feel right at home, just the mother India is. Always good to be around familiar surroundings I say! Lol.
Reply
-3Pradish says:
Monday, November 9, 2009 at 12:21 pm
I am sure you feel at home in Japan if that is indeed where you are staying. The Japneses must be extraordinary tolerant to allow a lower primate to live amongst them in their society. LOL
Reply
-3Pradish says:
Monday, November 9, 2009 at 12:28 pm
Also Carlos, I hope you know that your own people are guilty of white worshipping as well, despite your accusations towards me. I’ve seen plenty of young negresses and niggers who dye their hair blonde or red, or add brown/yellow streaks throughout their hair. You apes are every bit guilty of trying to worship and imitate the white man as anyone else. You simply deny that you do it the most ferociously. Again this proves that you are what you eat, hahahaha.
Reply
+3Carlos says:
Monday, November 9, 2009 at 1:36 pm
You are right, for once. That was indeed true back in the days, but that is not the case mostly. In the old days Blacks were taught and made to feel inferior compared to their White counter parts. They were taught to be ashamed of being what they were and to idolize Whites, but nowadays and especially during the 60’s that all changed and Black pride and Black self-pride grew out of that. Also, dying one’s hair has nothing to do with race. Has to do with beauty. Also, you have asians doing it and Indian women doing it as well. Has nothing to do with worship.
Unlike India, we don’t have commercials to bleach our skins and yearn for wanting to be White. For God’s sake, have some pride in your race. Most Blacks do. I know you want us to be demonized, but my Negro with straight-haired friend are so sadly misguided. Lol.
+3Bronze Breeze says:
Monday, November 9, 2009 at 11:12 am
I said you empty headed furry little PAKI Chimpanzee should do some basic learning …You said you lots “do not riot on the streets and assault innocents on the streets”
Lets talk about the PARTITION in that your God forsaken India where you all worship Cows. ….The partition resulted in extremely macabre violence and one of the largest migrations in history. Partition deaths throughout India and Pakistan numbered between 800,000 and 1.5 million, while some ten to twelve million migrants moved across the new borders in Punjab and Bengal. In addition, tens of thousands of girls and women were raped and/or abducted.
You are really a PAKI idiot!
Reply
+4Bronze Breeze says:
Monday, November 9, 2009 at 11:18 am
PRADISH… I said you empty headed furry little PAKI Chimpanzee should do some basic learning …You said you lots “do not riot on the streets and assault innocents on the streets”
Lets talk about the PARTITION in that your God forsaken India where you all worship Cows. ….The partition resulted in extremely macabre violence and one of the largest migrations in history. Partition deaths throughout India and Pakistan numbered between 800,000 and 1.5 million, while some ten to twelve million migrants moved across the new borders in Punjab and Bengal. In addition, tens of thousands of girls and women were raped and/or abducted.
You are really a slimy, greasy PAKI idiot!
Reply
-4Pradish says:
Monday, November 9, 2009 at 12:24 pm
And you are a slimy greasy gorilla who has no basic hygiene skills. Let’s talk about how you people commit horrific acts of rape, murder, and robbery in the countries which host you. You commit almost fifty percent of all the violent crimes despite being 12 percent of the population. Also, 1/4 young negro males are in jail right now. Then you blame it on slavery when it is your own fault for being an inadequete race who has failed on so many levels. HAhaha.
Reply
+4Carlos says:
Monday, November 9, 2009 at 1:00 pm
Wrong again. Clean that upper lip or yours to stop smelling the funk. You do know that you got your facts wrong, especially rape and most murders that Blacks commit are Black on Black crimes. You have no idea about the Slavery issue as to why and how Blacks(which I add have the right to engage in that topic)Blacks usually don’t feel inadequate about themselves. You are referring to some Chinese men and Indian men such as yourself.
Most Serial killers or the insane kind were committed by Whites. Get your facts straight.
9X out of 10
We failed?? You are truly unique, funny. But most definitely a coward. You would never spout this kind of rant in front of other Blacks, not for a second. Firstly, they would laugh so hard, they wouldn’t know whether to put you into a comedy club or beat the living Shiva out of you.
*Still lame, try again*
+3Bronze Breeze says:
Monday, November 9, 2009 at 6:08 pm
Pradish, you talk of basic hygiene, when you little, furry, slum-dwelling chimpanzees come straight out of the Gutters of Bombay and Calcutta, com’on get real! No wonder you all come here to the UK bringing your Cow worshipping, your dehumanized women (thanks to your mentality) and live 20 families crammed into a stenched up 3 bedroom Victorian house. All working in the same tax-dogging corner shop, all lying their ways to claiming every monetary benefits the British society has to offer, then you furry creatures come out thinking you lots are something. Sneaky little slum-dwelling, furry PAKI Chimpanzees.
+2Carlos says:
Monday, November 9, 2009 at 7:47 pm
Maybe that is the reason why so many of them come to the states. We have lots of cows, but couldn’t they go to Argentina? They have cows there too. They should go and bother them. There women were raped? Good God, what the hell for. It would take a week to wash the stench off your cock!
Shiva willing!
The point is, idiots like Pradish, I know his kind so well. In the city where I live in Japan, we have lot of Indian and Paki students, the men always complain that they can’t get Japanese women, always. I always see them alone and they always dress like…well, strange. Also, Japanese people are so sensitive to smells and oders. For example; garlic or even perfumes. But since many Indians and Pakis smell like their body was never bathed in Soap and most Japanese that I know say, Indian people smell so bad.
Japanese tend to go for subtle smells. That is the main reason why you don’t see many Japanese women dating them.
But yet, they want to talk about Blacks and try to talk shit about us(always behind our back, never to our face, typical cowardly baboons they are indeed)in the hope Japanese women will date them, I might see one Japanese girl and an Indian guy every 2 months compared to other races. As I said before, they are just too pathetic the racists idiots. What other country do you know shows commercials for men how to change your skin color?? If that doesn’t say loser, get a life, I really don’t know what else will.
Reply
+4David says:
Monday, November 9, 2009 at 11:17 am
Pradish, you are a sad and pathetic individual.
Every society has its maggots lurking in rotten meat. I have encountered equally nasty pieces of work such as you among White Supremacists, Japanese ultra-nationalists, Chinese Fenqing, etc.
You’re all the same despite having competing objects of abuse. You are all the same inadequate, emotionally damaged half-men.
I’m white British, by the way … so you know where next to aim your vitriol.
Reply
-5Pradish says:
Monday, November 9, 2009 at 12:20 pm
I find it funny how you side with the niggers. lol
Yes there are racist ultra-nationalist Chinese, Indians, and Japanese. But when blacks do it, it’s perfectly okay because they’re just innocent little victims who can do no wrong, eh?
You whites in the west practically worship the negro at his feet. You white liberals are some of the most pathetic of all, right down there with these chimpanzees. You are too chickenshit afraid of negroes so you take out your anger and frustration out on other minorities. lol
If anyone is inadequete it is you, being the cowardly little dog you are who’s too afraid to stand up against negroes raping your women and destroying your societies from within.
So let’s here it, David. When are you going to condemn the black racists on this site who make plenty of racist comments against Indians, Japanese, Chinese, and other Asians?
Reply
+3Carlos says:
Monday, November 9, 2009 at 12:45 pm
Only to an individual with an IQ the size of a a walnut. Why would anyone in their right mind give someone or something as yourself credibility. I don’t know what is is or why you have a high inferiority complex, so much that you just can’t stop by making you and your dusty curry-smelling ilk and by that I mean, racists, vile ilk such as yourself.
Why would David have to stand up to Blacks when he is obviously and like most Brits are NOT clearly racists as you might want to believe or wish. Guess what…the Blacks in the UK are not destroying the country…News Flash!!! Try again. Its someone else.
No one ever said that Blacks think that racism in any form is acceptable, that rant is coming out of your foul mouth and small brain or lack thereof!
*Sigh* Try again.
Reply
-4Pradish says:
Monday, November 9, 2009 at 12:47 pm
lol The nigger is still being racist but denies being a racist. I guess if it’s your right to call me a curry breath, it is my right to call you a porch monkey who grows fat from eating watermelon, hahaha. I believe that would be an accurate picture of your life.
Reply
+4David says:
Monday, November 9, 2009 at 12:45 pm
First, Pradish, I don’t “take out my anger and frustration out on other minorities”.
I wasn’t bashing Indians, I was bashing you as a racist.
Second, “When are you going to condemn the black racists on this site who make plenty of racist comments against Indians, Japanese, Chinese, and other Asians?”
I do condemn them as well. In this case though when someone like Bronze Breeze tries to argue with you by citing facts you just come back with abuse. The fact he responds with abuse is understandable, if regrettable.
Of course, being a “white liberal” I actually had a really great time in India. :p
Reply
-4Pradish says:
Monday, November 9, 2009 at 12:53 pm
Haha David, you are a funny little man. I will cite fact if you wish.
http://www.city-journal.org/html/eon2007-04-02hm.html
In New York alone, they commit 68 percent of all crime despite being 24 percent of the population. And that is only one city. If you truly wish for me to cite facts, then I can. But I warn you, you and your negro pets will not like what they and you will see.
And you are a liar for saying you condemn black racists, my friend. Bronze Breeze has said plenty of racist things even before I posted and yet I did not see you condemn him one bit. The fact that he also responds to racism with even more racism is telling about the kind of person he is. Face it David my friend, you whites have been emasculated in your own countries. You are unable to stand up to the negroes in your own backyard and if the day comes when they outnumber you, I have no doubt that you will flee like a coward to whiter suburban neighborhoods while paying lip service to blacks being your equals. White liberal hypocrisy at its finest! Better drink down that champaign fast my charming British chap! No telling when your own neighborhood will turn into Detroit! Hahahahaha.
Reply
+3Carlos says:
Monday, November 9, 2009 at 1:22 pm
Keep spousing lies, it is really amusing. You’re trying so hard to make sense, but failing miserably at it.
David says:
Monday, November 9, 2009 at 1:52 pm
One more point. You say:
“And you are a liar for saying you condemn black racists, my friend. Bronze Breeze has said plenty of racist things even before I posted and yet I did not see you condemn him one bit. And you are a liar for saying you condemn black racists, my friend. Bronze Breeze has said plenty of racist things even before I posted and yet I did not see you condemn him one bit.”
You may be right. I may not have read far enough back.
+3Bronze Breeze says:
Monday, November 9, 2009 at 6:11 pm
Pradish, you talk of basic hygiene, when you little, furry, slum-dwelling chimpanzees come straight out of the Gutters of Bombay and Calcutta, com’on get real! No wonder you all come here to the UK bringing your Cow worshipping, your dehumanized women (thanks to your mentality) and live 20 families crammed into a stenched up 3 bedroom Victorian house. All working in the same tax-dogging corner shop, all lying their ways to claiming every monetary benefits the British society has to offer, then you furry creatures come out thinking you lots are something. Sneaky little slum-dwelling, furry PAKI Chimpanzees.
+3David says:
Monday, November 9, 2009 at 1:26 pm
Pradish, I don’t give much credence to neo-conservative journals generally. But I’ll concede a point: We “white liberals” do have a blind spot when dealing with ethnic issues. Political correctness does stifle debate.
The problem is when you ascribe thee problems to racial inferiority. If you were living in New York in the 1850s you’d be saying the same thing about the Irish.
Reply
+1Hellotoyouandme says:
Monday, November 9, 2009 at 3:57 pm
We just need a race of violent human flesh eating, necrophiliac, body harvesting-egg laying, alien life forms from space to come down and reign havoc on earth. Im pretty sure this will turn Chinks, Hicks, Niggers, Spics… (whatever the term used for an selection of ignorant people from a certain race)…. back into regular Asians, Caucasions, African, Spanish. Well Lets just say ….back into civilized Humans.
You guys get the drift.
Reply
Charlie Hustle says:
Tuesday, November 10, 2009 at 5:02 am
Hate Hate Hate, good thing you are in the good ole USA because in many of these other places you cannot state your hate because you are not allowed.
I say if you hate so much go back from where ever you came from.
I just bet 95% of these people that hate do not work. I work with all races and we all seem to get along just fine. In fact, it was an Asian person that helped get me in here and fought for me to stay when my contract was up.
I am sorry for anyone that has to deal with these people that hate so much.
As for the dude from India, LOL India, only thing I really know about India is USA uses you guys as a buffer between USA and China. If China ever steps up and gives the order to charge were going to use India to help hold them back that is why we ship jobs there.
Reply
AMERICAN says:
Thursday, November 12, 2009 at 6:28 am
I am a White American, There is nothing wrong with her. If you damn chinks don’t want her then send her to America. We will take care of her and she can be ANYTHING she wants to be. GOD BLESS THE USA!
Reply
+1Joseph Liang says:
Thursday, November 12, 2009 at 6:32 am
Racist Chinese disgusts me. I am happy to be in the U.S. Lou Jing is beautiful! Get a grip!
Reply
US John says:
Thursday, November 12, 2009 at 9:01 am
China may be progressing rapidly economically but as far as social attitudes go it is way behind and very racist and archaic. It is an intolerant society to be abusing this beautiful girl in such a way. There is no place in this world for such an attitude. Such an attitude is not tolerated here in the US and it is a better place because of it. China…wake up! there will be a lot more of this if you want to enter the world stage..get used to it and accept it.
Reply
+4Jess says:
Thursday, November 12, 2009 at 10:13 am
This girl is beautiful and all of you mainland Chinese haters out there need to leave China and see the rest of the world. The world is a rainbow of colors, not just yellow! Get off of your high horses, people of all color and race deserve the same opportunities and pursuit of happiness.
Ok, her mother had an extra-marital affair, how many mistresses do the government officials have? How many people have extra marital affairs everyday? The attacks are because the father is black.
It is so heartbreaking to me, as a Chinese woman from Shanghai to see the amount of ignorance and hate among mainland Chinese people. The comments are so ridiculously stupid, spoken truly from frogs sitting at the bottom of a well.
Get out, travel, see how great other cultures are and how different the rest of the world is from China. Look inside yourselves before you pass judgement on other people.
I really hope Lou Jing is able to come to America. I would love to meet her and give her a hug. She is such a sweet girl and would be much better off in the U.S.
Reply
+1PAL says:
Thursday, November 12, 2009 at 10:25 am
The the world really hates BLACK skin. I’m sure if she was mixed with a white person, we wouldn’t have this discussion. For all of those that like we have progressed-guess what?
Mixed race couples is some what accepted in the US and UK but every place else it really makes life challenging for the child. My heart goes out to the mother and more so to the little girl. What a shame.
Peace and Love-PAL
Reply
+1Bronze Breeze says:
Thursday, November 12, 2009 at 6:25 pm
I do not know from what planet you ugly Duckling flew in from. Africa is at the center of planet Earth and her people are center stage in this world! …So who care about the opinion of a tiny little alien chimp of yourself thinks. You name it, in sports, Music, Entertainment, Academia and History. What else you envious little plunkarious alien…Why don’t your own type standup and be counted just as we ‘Blacks’
Reply
Raka says:
Thursday, November 12, 2009 at 9:09 pm
Hey Bronze breeze….. change your comics man ….. africa is the centre of the sewerage pit of the world …. you seem to be the same as your …..hit-n-run jackhead brother that came to shanghai many years ago …. by the way …..did your Mommy not tell you to stop playing with the computer ? from a white born in africa …take note…pure white
Reply
Italian says:
Friday, November 13, 2009 at 12:02 am
There will be not white anymore in few years.. my friends!
Black e arabs are litteraly conquering Europe…
If u see in GB the first name for children now is Mohamed…in italy is almost the same.
“Pure white” will be a memory very soon…
The future of the world
is dark skin, china, india…
bye bye my friend…;-)
Reply
Bronze Breeze says:
Friday, November 13, 2009 at 4:08 am
I do not know who made your Italian jackass White…. Ridiculous! You are either more pink than red or more red than pink, and that’s whether your jackass likes it or not!
Actually I wouldn’t mind if really you turn pure white…At least you will be well on your way to 6ft under.
Dee says:
Friday, November 20, 2009 at 7:10 am
And the problem here would be?
E molto triste vedere il razzimo nella mia cara italia. Sono Italian come te, sono nata li e L’amo molto anche se la mia pelle e scura e non biancha come la tua.
Il razzismo e sempre cosi triste…
+1Bronze Breeze says:
Friday, November 13, 2009 at 4:40 am
Raka …..white born in Africa…. So from day 1 you were a loser… You made mention of that: “hit-n-run jackhead brother that came to shanghai many years ago” ….Going by your comments I suppose you are referring to Mr Nelson Rolihlahla “Madiba” MANDELA….. That man is known across the world, as for yourself, who knows you? Does that not say something about your jackass being a looser? If you don’t know that by now that means you are yet to grow a proper brain cell and still going about with the plastic ones you African born ‘whites’ came with. Also be careful not to open your mouth too wide, don’t forget you were all given a trashing all over the Continent where ever you chose to pick a fight. And also remember, we African did not come looking for you lots, you lots came looking for us, and even today you lots are still coming, still coming for land and resources…. Now you know why we are considered the center of planet Earth.
You brain dead ‘white’ born in africa
Reply
Bronze Breeze says:
Friday, November 13, 2009 at 4:54 am
Raka…..Remember the “One Settler One Bullet” slogan in those days? he-he-he-he.
I see your jackass narrowly escaped that ‘VIP’ treatment!
Reply
Italian says:
Friday, November 13, 2009 at 6:48 pm
Yeaaa man but ur people will be history very soon!
That’s is a fact…;-) It is just a question of numbers!
Sorry man! :-)
Sorry “Pure white”.. we will remember u all with passion!
It’s a promise! hahahahaha
+5Ariee says:
Thursday, November 12, 2009 at 1:03 pm
People. seriously..get over it. you dont her mother circumstances at the time of her affair. this girl is INNOCENT. she didnt ask to be mixed. or born for that matter. she was brought here. OH and by the way..im sure if this was an asian-white mix instead of asian-black then this would have NO press at all! which is pretty f***ed if you ask me. i mean seriously come on, how many indians,cubans,and other cultures, who ARE NOT BLACK, have dark/tan skin. so she is truly being punished for the black fact. not the tan fact. people are lame, and honestly a lil bit JEALOUS that she isnt plain and boring like the rest of us. GET OVER IT! BY THE WAY…i think shes the winner here. she can be two cultures and not have to be chained to either one.
Reply
+2Kongcrete says:
Thursday, November 12, 2009 at 1:11 pm
All the latest Chinese pop songs incorporate hip hop elements including rap. Wake up, assholes! Your idols pretend to be black, yet you hurl racist remarks at this beautiful girl! As a Chinese bass-player for Kongcrete an NYC-based hip hop band comprising black, white, and yellow band members, I hope someday we will find many more mixed artists hitting the mainstream Chinese music market. Is China ready for ghetto rock? Check out http://www.myspace.com/kongcrete and let us know. Lou Jing, we’re cheering for you! Don’t ever give up, girl. Stay strong.
Reply
-4tamsier says:
Thursday, November 12, 2009 at 2:09 pm
I am a African and very proud of my African lineage. Because I am so proud of my lineage, it has always been dinned into me by my parents to marry one of my cousins so that I can purify the ancient blood of my family. This is the reason why I can understand the plight of the Chinese. However, my parents have also brought me up to respect other people and be friendly to others regardless of race. In fact, my closest friend is white. However, if the Chinese wants to purify their bloodline like the way my parents brought me up, how come you see lots of them involved in mixed relationships with white people? And how come I have never heard any remarks from them about that? Because of this, I strongly believe they are hounding this girl because of the fact that her father is African-American – as someone rightly noted above. This goes to show you, these people have no respect for Africans and all those who descent from them. Speaking from personal experience, I remembered one day walking into a club and saw a female Chinese friend of mine whom I knew from my university days long time ago. We saw each other and gave each other a big hug and two kisses on the cheek and began catching up about the old days because we haven’t seen each other for years. A Chinese guy seating opposite us began to give us dirty looks. I had to walk up to him to reassure him that she is not my girlfriend but an old university friend of mine and I am very happy with my African woman thank you very much. He started pretending that he was not thinking what I know he was thinking.
People can date whoever they choose I am not here to stop them. However, I would like to know why do black people in particular [not all I must add] would never date people of their own race? What is it about your race that your hate so much that you have to go and date another race? I am sure I am not going to get an honest answer on this site, because I have heard many people say race doesn’t matter, but in fact, many have said to me they will never go with people of their own race. In my culture, especially among the old families, marrying someone whom you share the same culture and someone who look like your parents and come from the same family is the greatest honour you can bestow on your ancestors. By refusing to go out with someone whom you share the same culture; you are virtually saying you hate yourself and dishonouring your own ancestors. Again, not all black people think like this but there are many otherwise we would not have a large percentage of mix children going around [no offence to the mix I am only giving an example]. In other words, I can understand a small percentage of blacks saying I know this person from a different race for a long time and I have fallen in love with them but not a huge percentage. In the United Kingdom, 50% of all Caribbean children are mixed. I think this is sad because i know it is motivated by self hatred. Of course there are people from other races who will never go out with someone from their own race. A good example is a white female friend of mine who refused to go out with white men but prefer black. However, I am more concerned about the blacks. Also all I seem to hear from many blacks on this site is ‘this girl is beautiful….’ Yes! She is beautiful every woman is beautiful and so are our black sisters. Before you expect any respect from someone else, you must first respect and value yourselves. You start by loving yourself and valuing and upholding your tradition and the best way to demonstrate this is by marrying your own. By marrying your own, you demonstrate to others that you respect the ancient tradition you are born into and they will not have any ammunition to come back against you. In fact they respect you more rather than thinking you have the moral duty to dilute the races of the planet.
Peace
Reply
+2Bronze Breeze says:
Thursday, November 12, 2009 at 6:15 pm
What a plunker you are! You TRASH claiming to be African? show us your ‘African face’ you are some bloody impersonator albeit you attempt is far from being a ‘nice try’ it’s so CRUDE!
Reply
-1tamsier says:
Friday, November 13, 2009 at 12:50 am
Why do you think I am not African? What is it about my comment that is so crude?
Reply
+2PC says:
Thursday, November 12, 2009 at 11:02 pm
I honestly believe Lou Jing is a beautiful woman. With the exception of her skin color and maybe her hair, she LOOKS ethnically Chinese.
In fact, when I first ran into her pictures, I just thought she was wearing a bronzer or some skin darkener product. Thought maybe she was an actress doing a role.
She’s a lovely Blasian and I truly hope she goes far in life.
Reply
+2AsianZing says:
Friday, November 13, 2009 at 4:30 am
Had to stop reading the extremely upsetting and racist commons about Lou Jing and her mother. As a Chinese woman living in America, I am saddened by racist commons made by my fellow Chinese. If one’s objection is to the extramarital affair, then should it matter to whom she had it with? Would it be more accept if she had an affair with a Chinese man or a white man? If your answer is yes, you are a ractist. Both mom and Lou Jing are being abused because the affair was with a black man. It is RACISM.
The mom has the courage to bring up Lou Jing to a smart, productive young lady by herself, she deserves to be praised not condemned. Lou Jing, if you are reading this. Please remember you are a talented and beautiful young woman, keep your head high.
Reply
+2Gardengirl says:
Friday, November 13, 2009 at 9:15 am
In any truly civilized part of the world racism is disdainful. I am shocked reading many of the posts here. You racists should be full of shame. Your ignorance only makes the world a worse place. All history is a very harsh judge of racists and I only wish you will one day open your minds and feel how shameful your hateful behavior truly is.
Reply
+3tamsier says:
Friday, November 13, 2009 at 9:56 am
I am still baffled as to why Chinese people hate Africans anyway. Judging by this girl’s statement, her father is not even African. So would one Chinese person on this site tell me why you hate Africans? The African race are the only race in the world whom you can go to regardless of your race and they still greet you with a smile and give you the best welcome as if you are part of their family. Even the poorest of them will use everything they have to ensure you have the best hospitality and welcome. In fact,in African culture, it is considered rude bad breeding not to do so. Name me one place in the world apart from the African continent, were someone of African descent can go without being pointed at or badly treated. The Chinese people living in Africa are welcomed by the Africans and Africans being racist against the Chinese or treating them wrongly would never even cross their mines. This shows you that, financial wealth means nothing and a country’s wealth should be judged not by its the financial standing, but by the morals, etiquette, behaviour and tradition of its people. And based on these factors, the Africans are far superior to any other race – the Chinese included.
Reply
WTF says:
Friday, November 13, 2009 at 10:07 am
Welcome with a warm smile? Like Somali pirates?
Reply
Bronze Breeze says:
Friday, November 13, 2009 at 9:53 pm
Hi faceless cunt! Why not reveal identity.
Reply
-1Hans says:
Friday, November 13, 2009 at 10:12 am
perhaps people hate africans due to recent news. See, if i were not befriend with some kenyan and nigerian people i would not know whether there is actually nice african. from what you can see from the news, you can always see massacre in sudan, somalia, and the list goes on. also due to the fact that in western countries most criminals are coincidentally from african race thus explaining why there is racist view against african, but then again, not all africans are violent.
Reply
Bronze Breeze says:
Friday, November 13, 2009 at 9:50 pm
The problem withe Africa today is that it is reshaping it’s political structures after it’s destruction and the carving up of the continent by the European colonist totally disregarding ethnicity, clans or peoples. In any case, the resulting death from wars in Africa stretching over a 60 year period is no where near the scale of deaths recorded from European wars or Wars in Asia. Remember no one holds the monopoly to racism or hate.
Reply
+1tamsier says:
Saturday, November 14, 2009 at 2:01 am
Hans,You claim to have African friends, I don’t know what you talk about but by the looks of it, not much. Just because of a few stupid Africans in the news you tarnish all Africans with you brush. I was one of those injured in the July 7th bombing in London, but that did not make me hate all Muslims. As for Sudan, lest not even go there. Who is supporting the ass wholes killing the Sudanese people which had led to protest by several famous people in the Beijing Olympics? Answer: China. As for people killing their people, remember Tiananmen Square 1989, Tibet, etc. Are you telling me the Chinese are so innocent as if butter wouldn’t melt? As for the West, well lest not even go there because I will be here all day listing their acts over the centuries till present. Did you mention these? No! Of course you didn’t. Further, there aren’t that many Africans in Western countries [in comparison to other nations/races] for them to be the greatest criminals in the West. Yes! There are criminals everywhere, and the Africans who are criminals in the West tend to engage in white collar fraud and not violence. However, as history teaches us, they do not have a monopoly on this. Most frauds are committed by Westerners themselves at the top of blue-chip organizations. Everyone is at it:- the Africans, Indians, Chinese, Arabs etc. As for the most gruesome crimes in the West, it is actually Westerners who commit them e.g. pedophilias; rape; top end drug trafficking [the Chinese by the way are also known for this]; serial killers and the list can go on. But did you mention this? No you didn’t. The Africans in the West are not that many in comparison to other races/nations [see home office records of the relevant countries]. The majority of the blacks in the West are actually of African-Caribbean or African-American descent that are born and breed in the West and they have every right to be there. You say you have African friends and still you cannot tell the difference. Shocking!
Reply
-3WTF says:
Friday, November 13, 2009 at 10:04 am
What’s politically correct is scientifically wrong. Anti-racism is politically correct. Therefore, we Chinese enjoy the privilege of discriminating against all the inferior black, white, and…(green?) worms.
Reply
+1Choco says:
Friday, November 13, 2009 at 11:04 am
^wtf is right? Get out of here with that Chinglish shit. Let me break it down for you in your own tongue: 你是一个大王八蛋。我操,你真笨!来这边,英语镇么差,还敢骂人?好好学习吧。太可怜!And for everyone else that wanted to know what I just said? I had to break it down for this ignorant fool that tried to come here and spread his racist bullcrap, but ended up making a fool out of himself.
Reply
+1Bronze Breeze says:
Friday, November 13, 2009 at 11:02 pm
If you have a Mirror in your shack please use it……But be kind to your mr ’superior’ looks.
Reply
Nadia says:
Sunday, November 15, 2009 at 3:04 am
You are an idiot.
Reply
tamsier says:
Friday, November 13, 2009 at 11:13 am
Discriminate!Go ahead and discriminate if you think it will give you a bigger willy. You can only do that in China not in Africa. Therefore, your so called discrimination is meaningless. Because you are not important, the Africans will laugh at you before kicking your ass if you go to their continent trying to rise above your status.
Reply
Justin says:
Friday, November 13, 2009 at 1:42 pm
Not so much kicking of asses, but more like dealing in machete deaths.
Reply
+1Bronze Breeze says:
Friday, November 13, 2009 at 9:30 pm
…..And as for you lots, Napalms, Chlorine gas, Hydrogen and the Nuclear Bombs
Reply
+4nadia says:
Friday, November 13, 2009 at 3:44 pm
china you disgrace me.this is beyond racism, and really needs to be addressed, it’s amassive problem amongst the chinese race. your international repuation has completely tarnished outside of china
…makes me ashamed to be chinese
Reply
+3Leanne says:
Friday, November 13, 2009 at 9:18 pm
Has the world gone mad? I’m truly ashamed to be chinese right now because of how utterly disgusting the majority of the comments on here are. Being chinese i’ve experienced racism before, and as such i would NEVER consider judging anyone based on their ethnicity or appearance because i know how degrading it feels.
truly fucked up.
Reply
Kind Sir says:
Friday, November 13, 2009 at 10:59 pm
China is still young when it comes to race relation. I am sure with more education and exposure they will one day embrace enlightenment. Heck the majority of people in the west with years of experience still haven’t crossed that bridge yet. Suffice to say humanity is the same all over the world when it comes to differences.
Yep, there are racists twits from every nation.
Reply
xino says:
Saturday, November 14, 2009 at 9:58 am
If Chinese won’t accept us black people, then I suggest we should bomb China!?
who you gonna call? ghost bust…WRONG, Call the Talibans to bombo mother farking China land!
Reply
Mao Lijiang says:
Saturday, November 14, 2009 at 6:24 pm
Japanese were not wrong – CHINESE ARE PIGS…..
Reply
-1Bronze Breeze says:
Sunday, November 15, 2009 at 5:42 am
It is so amazing how ones opinion can overtly change overnight. As an African I have always sympathize with the Chinese and the struggles they’ve been through at the hands of aggressors after aggressors. It was by accident that I stumbled on this website which to me was quite enlightening. Now that I know what these RETARDS think of me, it’s better they know what I think of them now……I would not give a SHIT for them! Come to think of it…..Maybe the Japanese actions against them was right after all. he-he-he-he
Reply
+2Alice says:
Sunday, November 15, 2009 at 9:40 am
You seem to be forgetting that Lou Jing is Chinese too. Are you saying that you would cheer if she was murdered?
See that lady up there in a blue shirt holding her hand? That’s her Chinese mother. Are you saying that she should be killed too? Are you saying that you would cheer if Imperialist Era Japan’s Army brutalized Lou Jing’s Chinese grandparents?
Reply
+1Sam says:
Tuesday, November 17, 2009 at 10:55 am
It was OK for the Japanese to rape women, kill babies, forced fathers to have sex with their daughters, bury people alive for fun, etc, etc just because a few Chinese people don’t like Black people? Wow, you have amazing logic. With logic like that, how could Chinese people be so racist against Black people, right? :D I’m kidding of course, because you see, I’m not as stupid as you. I understand that your ignorant self isn’t the spokes person for the entire Black community. Hard concept to grasp that the comments of a few don’t represent everyone’s view, huh?
Reply
+1Bronze Breeze says:
Sunday, November 15, 2009 at 6:03 am
The Chinese are all over Africa, as we speak their are over 100,000 Chinese residing legally in Nigeria and about the same number living in the country illegally……Once the Africans realize what retarded mentality the Chinese have, the relationship will soon turn sour. When that happens the Chinese population risk an expulsion. Be warned it’s happened before in East Africa and to Asians, it can happen again!
Reply
+1tamsier says:
Sunday, November 15, 2009 at 7:47 am
Just like you Bronze Breeze, I came across this site totally by accident from my local radio station’s website. I hit the link and I couldn’t believe what I was reading. I have expressed somewhat similar remarks about the negative implications this will have for Chinese in Africa – under another topic :’Nude Underground Rafting By Chinese Girl & Black Man’ – on this very site. This is now on the web and it cannot be retractred. Many have copied and pasted it or made links to this site. The African forums are all aware of it and are in up-roar about this. It has created so much negative response on the net and controversy. It is almost like when the British National Party’s [the british nazi party] members list was put on the net. Which is such a shame because I originally never saw the Chinese people as utter racist, yes, there are racist Chinese but I thought they were a minority. Not a good image of China is it? Especially when it is about a silly television programme and the girl has nothing to do with Africa by her own words. What a big mistake, what a stupid mistake. One piece of advise to China, if you want to copy others, e.g. the Westerners [not that all Westerners are racist pigs]copy their good bits and leave the bad bits. Only fools want to be bad.
Reply
Goodness says:
Sunday, November 15, 2009 at 11:57 am
But will the relationship turn sour while Africa still has some natural resources left? That is the question.
Reply
+1xino says:
Sunday, November 15, 2009 at 8:22 am
“The Chinese are all over Africa, as we speak their are over 100,000 Chinese residing legally in Nigeria and about the same number living in the country illegally……”
Is this true? well no fucking shit sherlock, I didn’t know that.
Nah, I just hate racism so much.
Breeze you speak truth. When I think of Chinese people, I think about how they’ve been opposed so many times and attacked, especially by the Japanese. That is why I favour them more than Japanese because of what they’ve been through in history. But now that half of China country is standing on their own feet, they think they are better than others.
Reply
+3thegreatY says:
Sunday, November 15, 2009 at 4:01 pm
you know, to me, what’s more pathetic than a bunch of racists abusing one their own?
1. Idiots who rush to the conclusion that ALL chinese are like this and therefore “let’s bomb them”. I mean WTF?! Here’s the news, there are 1.4 billion people in China. Internet users still make up a minority. Internet users who ABUSE lou jing makes a even smaller minority. DO YOUR MATHS.
2. Self righteous people who SICKEN me with “oh I’m ashamed to be Chinese”. You’re even worse than the other idiots mentioned in 1 because you ARE chinese. 1.4 BILLION people.
I’m sure you don’t want to know what I would’ve done to her if I ever found out she cheated on me. But I can tell you now I’d be more angry if she had the baby of the lover. I’d be even more furious if she had the baby of an individual of another race.
Call me what you like, I don’t care. But before you dismiss this as a rambling imagine you’re the husband:
You love your wife.
You’re excited because the product of your love is about to be born.
You tell EVERYone about your wife’s pregnancy.
You ask me what’s the difference between if she cheated with someone of her own
race and someone of another race?
Well, you see, most people can TELL if the baby’s father is of non-asian race. In those days, where the community was more tightly knit, these news won’t and can’t be kept a secret. EVERYONE would know by the end of the day. You’ll be the cuckold that married a slut. Your reputation will be ruined. Your career would be ruined. You’re riding high, then you’re brought crashing down.
The husband abandoned his life in China and left for Japan. He didn’t remarry for another decade. What has he ever done wrong but to marry the woman he loved?
(Of course, if he were a generalising idiot like some of you he would’ve advocated that all women be locked up and given clitoridectomy.)
Does she deserve the adversity she faced? I’m not g-d so I can’t judge. Does she deserve my admiration for facing such adversity? Don’t ask me. Ask her ex husband.
Reply
tamsier says:
Sunday, November 15, 2009 at 9:51 pm
No one would argue that what the woman did i.e. cheating on her husband was wrong only idiots would do that unless the husband was abusive/violent etc. If the husband was a decent human being and a good husband of course he deserves sympathy and the woman and the African-American man she had a fling with should be castigated for what they have done. I would even say more so the woman than her lover. She is the woman who is married to her husband, she is the one who wrecked her marriage and no one forced her to have a fling with a foreigner visiting China. However, does that justify racist remarks against the entire African race who have done nothing wrong and are not even part and parcel of this affair? No! Absolutely not. As for your statistics, the hatred running in China against this girl who have done nothing wrong, and the African race who have nothing to do with this and carried forward to this website and others by the Chinese are good samples of Chinese people’s general feeling about Africans. After all, when statisticians want to gather information/evidence about a population’s general feeling about something, they don’t interview the entire population; they take substantial sample from all works of life. From their findings, they can estimate with a high degree of accuracy what the majority of the population thinks and they are mostly right. Of course not all Chinese are racist, but the majority are based on recent evidence.
Reply
+1t says:
Monday, November 16, 2009 at 4:30 am
You know what is fucked up in China. How the chinese government has killed so many of you chinese girls to make room for the chinese men. Now you have a multi-million female shortage. Nature dictates that woman are to be born in greater numbers than men and you all fucked up nature’s prescribes decree.
I mean what the fuck! You folks in china number what, 1.4 billion and counting! The freaking oil is running out and you are breading like there is no tomorrow.You people are eating away at the world’s natural resources while trying to sustain an unsustainable population model. Get a fucking clue.
I bet that big black dick was good as hell.
Reply
momo says:
Monday, November 16, 2009 at 7:20 am
I am a person of African descent and many of the comments above are self righteous (after you are all perfect ;)) and ignorant. In the end having black skin also means having a THICK skin. So I am not hurt, but feel sorry for people who have such small minds. At moments like these I am veru happy to live in the West.
Reply
+1Bronze Breeze says:
Monday, November 16, 2009 at 8:07 am
So you Mugu wants us to believe you are African? You said you’ve got a thick skin, but I think you’ve got a thick, fat, big head. Not to talk of the Bug fucking size willie.
Reply
+2china donaldson says:
Monday, November 16, 2009 at 1:33 pm
As an African American Woman, named after China I cannot help but find my self angry that I am named after such a disgraceful country. Many fail to realize that America/Most Western countries haved worked through its issues and can move past race in only 70 years. The fact that the Chinese are working towards ideas of whiteness is stupid. If anything all you racist asians should recognized your own beauty and know that no matter how much you lighten you skin, try to increase you height or shape of your eyes you will never be Caucasian. If anything you should be like the French and only focus on the beauty in your own culture. I mean china has alienated itself from outsiders for most of their history, but has never worked on way to make the ethnic minorities feel appreciated.
And how do the Chinese even dear talk talk about another nation/culture when it has never even attempted to work at understanding and resolving the issues in its own. As a college student I am now weary of the Asians that i sit next to in class and wonder if i should even trust them.
As an African American, i am happy to not be yellow or white. Because when i get old my skin will not crack or have nasty age spots or showy veins. And when we get sick our skin does not change colors and look nasty.
I know that my comments are ignorant and that is exactly the point. Why should people have to apologize for being xenophobic? Yet is a certain society contradicts itself and tries to condemn others i say fuck you!
At least Americans know they are racist, work through it or upholds it.
Oh and at least America provides for the lower classes, no matter what color. The Chinese wouldn’t know that with its stupid communism.
Reply
+1Alice says:
Thursday, November 19, 2009 at 10:42 am
“Many fail to realize that America/Most Western countries haved worked through its issues and can move past race in only 70 years.”
Don’t kid yourself. Discounting the fact that the US has had race issues for well over a century (Remember? The whole slavery thing?) the west still publishes studies on how Africans are ‘naturally’ dumber and masquerading it as science when we all know it’s really racism.
On television, how often do you see African Americans as the leading actors/actresses? How often do you see Latinos? How often do you see Asians? How often do you see Asians as someone beside the nerd, *~exotic dragon lady~*, or *~exotic submissive porcelain doll~*?
In the upcoming film Avatar: The Last Airbender, the characters are clearly meant to be Asian (water- Inuit; air- Tibetan; earth- mix of Chinese, Vietnamese, and Korean; fire- mix of Chinese and Japanese). Yet when the cast was announced, all the heroic characters (Katara and Sokka from the water tribe and Aang from the air tribes) were turned white.
community.livejournal.com/racebending
When was the last time you saw a major outpouring of help and emotion for a missing Caucasian girl? For a missing African American girl?
Listen to all the people crying how President Obama’s not born in the US just because his skin color is different.
Racism still exists in America. It’s just not as ‘in your face’ about it.
“If anything you should be like the French and only focus on the beauty in your own culture.”
The Imperialist Era French were all about focusing on their own beauty. Yup.
“I mean china has alienated itself from outsiders for most of their history, but has never worked on way to make the ethnic minorities feel appreciated.”
Well gee, I wonder why.
en.wikipedia.org/wiki/Imperialism_in_Asia#European_penetration_of_China
Oh, that’s right. Those silly slanty eyed people were too busy dying and shit.
“As a college student I am now weary of the Asians that i sit next to in class and wonder if i should even trust them.”
As a college student I am now weary of the [Africans] that i sit next to in class and wonder if i should even trust them.
And thus the circle continues. You should be working more as part of the solution not part of the problem. Show them that you’re understanding and open minded and you will open their minds. Show them hate and they (like you right now) will show you hate in return.
“As an African American, i am happy to not be yellow or white. Because when i get old my skin will not crack or have nasty age spots or showy veins. And when we get sick our skin does not change colors and look nasty.”
…that’s pretty hurtful. ;~;
Wah, don’t make me think about being old yet. I’m still only a high school student. D:
“I know that my comments are ignorant and that is exactly the point.”
Don’t parade ignorance. Ignorance breed more ignorance. If the people in this world (on both sides of the sea) try to be more understanding perhaps one day our children might actually live to see racism gone. If we keep shouting on about how proud we are of our ignorance, we will all end up bombing ourselves back to the stone age.
“Why should people have to apologize for being xenophobic?”
Because it’s the right thing to do?
It’s easy to be hateful, it’s hard to be understanding.
“Yet is a certain society contradicts itself and tries to condemn others”
Such as yourself?
“Oh and at least America provides for the lower classes, no matter what color.”
Which is exactly why we had universal health care without any probl- oh wait. See all the teabaggers carrying signs saying how President Obama (Off Topic: Back in election year, I backed cookies for his campaign. The people there working in the local Obama campaigns were very nice and there were people of every color supporting him. It made my heart feel all fuzzy. <3 ) is the Communist Nazi anti Christ.
"The Chinese wouldn’t know that with its stupid communism."
Modern China is a capitalist totalitarian dictatorship.
Communism is all about spreading the wealth and taking care of everyone (yes, regardless of color, Commies were actually quite progressive about race, they still killed a bunch of people though) through a big, centralized government. Government is a fun course. You should take it (and I'm actually serious. History, modern world politics, international relations, government, etc., are some of my favorite courses. Take some at your college. They're very interesting. Join the model UN or something too. It'll teach you to look at things from different perspectives and it's quite cool. :D )
Reply
Choco says:
Thursday, November 19, 2009 at 4:15 pm
Alice, the European invasion of China that you mention has nothing to do with how people want to bash those perceived as African, which is what we are talking about here…Africans weren’t the one’s carving up Shanghai and HK and dealing out Opium.
Also, all the racism in America is just as bad, but it makes this hateful prejudice against this young girl no less wrong. If you step in two shits and one is bigger and smellier, it makes the other one no less shittier.
Bronze Breeze says:
Thursday, November 19, 2009 at 4:29 pm
Alice, obviously you are not ashamed of your people’s crudeness, I see you trying to be the Ms ‘Moral High Ground’ here. Somehow in your warped mind we are guilty of your own racism. The question is what makes the Chinese think they can be racist toward us of African Ancestry? They ought to know that they are biting off much more than they can chew. You were quick to point out and I quote “the west still publishes studies on how Africans are ‘naturally’ dumber and masquerading it as science when we all know it’s really racism.” Who in the West?…You are the one attempting to masquerade your own racist thinking. People of African Ancestry are clearly more superior physically to any other race!! That you can prove anytime! And so what do the racist hold on to? ….Claims that they are mentally more superior to us lol. I have come across a few of them and in the end it becomes clear that with their ‘intelligence’ they aren’t even as smart as my little finger. You Chinese want to up the ante by being crude racist, you’ll get paid back in your own currency, simple.
Alice says:
Thursday, November 19, 2009 at 9:05 pm
Oh god this commenting system is so annoying. Anyway.
@Choco: And I will not disagree with you on that. The invasion thing is why Chinese people are distrustful of foreigners in general. What really annoys me about this is that they know they suffered and they know that Africans suffered too and yet they’re still racist towards them. The netizens there (like the netizens here) are both filled with pretty equal amounts of irrational hate. It’s really terrible and I want both sides to get along. :|
I am not saying that this is right (and I apologize if you think that’s what I’m saying. I’m bad with words. >_< ) but I am saying that this HERE is wrong too. It's just really annoying for me to see people spreading more hate…
For the record, yes, I have chided some members of my own family on being racist. It's not so different from chiding certain people here. Some of them have changed their views. :)
I don't want people (here or there) to dismiss others as impossible to cure and keep spreading the hate.
(And honestly, I want her to stay and become a famous TV host over there and educate more people.)
@Bronze Breeze: I AM ashamed of my countrymen's crudeness. Chinese and Americans.
"Who in the West?"
Google The Bell Curve.
Most recently: James Watson
I argued with quite a lot of people over the internet about this. I told them that people are products of their environments and the system in the US typically works against minorities. High schools with lots of minorities tend to be poorer and have less good teachers. The students are not dumb they just don't have the amount of equipment needed for them to reach their full potential. (As a Democrat, I support more funding for education especially for the more impoverished areas)
"You Chinese want to up the ante by being crude racist"
Instead of being racist right back at them perhaps you should try talking with the more racist folks and teaching them that you are smart and capable? It's hard but believe me it will make a difference.
Bronze Breeze says:
Friday, November 20, 2009 at 2:32 am
Alice, I know you are a racist, so why not be bold and come open on it? I can see you are trying to draw me into the issues of Race and IQ. You will have to fire the first salvo though.
capt. dude says:
Friday, November 20, 2009 at 6:37 am
Exactly. Typically “racist” and “ignorant” bullshit from Americans. Always pointing fingers at OTHERS WITHOUT even REALIZING that they ARE DESCRIBING THEMSELVES. It’s all keyword based automatic react and response (communism; chinese; racist; black & white; PCnesss). Pavlovian responses put there by the system (not saying there is a man behind the curtain who literally pulls strings and shit; Simply stating the fact that given the initial conditions of the SYSTEM this is WHAT we evovled to.)
FUCK america. Don’t know jack shit. Not saying I’m above you assholes. I’m the same, but you fuckers are ignorant too.
capt. dude says:
Friday, November 20, 2009 at 6:40 am
I do not condone this racism shit. What I’m getting on about is these American bitches (yes, I hate Americans, can you not tell?) always acting like they are above shit. You ARE NOT.
Seriously, what is the reality though? No one gives a shit. Just look at this board.
Bronze Breeze is just being stupid. Not knowing shit about shit. Go suck off your American masters.
+1Ty says:
Monday, November 16, 2009 at 1:48 pm
I am truly horrified by the Chinese reaction to this beautiful woman. I am an American Black man who had a serious girlfriend in China. We were together for 2 years and I visited her several times in her city of Shenzhen. Now I know what people were thinking when we were together in public.
It is clear how our children would be treated there. I once admired the Chinese people and culture but now I am sure that most Chinese are racist pigs and no better than European imperialists that destroyed the civilizations and peoples of the Americas under the name of exploration. ALL ZHONGGUOREN SHOULD FEEL ASHAMED!!!
I feel a very strong appreciation for the courage of my ex girlfriend Ying. She was very brave to face such racism by her countrymen in order to love me. Unlike her, it seems that many Chinese are cowards.
Reply
+1Sam says:
Tuesday, November 17, 2009 at 10:46 am
You’re coming off just as racist lumping all Chinese together with the racist ones. Wow you’re ignorant. I’m not surprised as you seem to want to play the victim.
Reply
+1wambam says:
Monday, November 16, 2009 at 11:14 pm
WHY ARE black people shocked by this?
Please wake up and realise this worlds attitude to DARK-SKIN,even chinese people with a little dark skin are victimised and looked down upon.
Be proud and stop responding to these morons online.
Everyone WILL be judged and skin colour wont be an issue.
Reply
Davis says:
Tuesday, November 17, 2009 at 2:09 am
It is amazing to read these types of threads. In America, Asians are seen as minorities too. I am disgusted by the comments that this day in time, the Chinese people are so racist…when they bleach their skins to look more white, in fact most Americans think they look like ghost–while White people in America sun tan…
Reply
PT says:
Tuesday, November 17, 2009 at 3:18 am
People shouldn’t be mean to her. Chinese are still more sensible than those in the West though who have deluded themselves into thinking groups are interchangeable. This as lead to large crime/gang problems in the UK & Canada.
http://www.charlesdarwinresearch.org/Chinese.pdf
http://www.charlesdarwinresearch.org/Race_Evolution_Behavior.pdf
Reply
+5angela says:
Tuesday, November 17, 2009 at 10:41 am
If this girl was a model in the states she would be hugely popular, and the media wold adore her exotic looks.
Reply
+4Julie says:
Tuesday, November 17, 2009 at 11:23 am
This is such a beautiful girl. The slander is such a shame. I pray she goes far in life.
Reply
+5Bronze Breeze says:
Wednesday, November 18, 2009 at 7:02 am
I just wonder why she decides to stay in that God forsaken place with all that crudeness and disgrace around her. She’s a drop of beauty in a sea of beastliness
Reply
Alice says:
Thursday, November 19, 2009 at 10:50 am
Well gee…
1. She has friends there.
2. She’s Chinese.
3. She has people who support and like her over there.
4. Over here, she has netizens who think that her home country should be destroyed in her name.
5. Over here, she has netizens who pretend that she doesn’t have friends and supporters in China.
6. Over here, she has netizens who ignore the fact that she’s Chinese.
7. Over here, she has netizens who will assume that she’s totally racist because she’s part Chinese and everyone who is Chinese is a racist.
I wonder why.
Reply
-2Fli says:
Friday, November 20, 2009 at 12:48 am
Dear Alice, I can understand black people…
Immagine if we 2 are in the desert and u have a gun..
Immagine if I star telling u
u r a monkey
U r inferior
U r an animal
U have no rights
U r children are animals too
What u would do (nobody could see u) with that gun?
Aswer please… ;-)
Same story here…
For chinese people the future will be harder…I can garantee u! ;-)
We do not need a new rich nazi kid in town.. No more, my friend!
If necessary a comple delete will be a realistic option…
Hope for them they will change! Otherwise…I m sorry!
Same story for nazi in Russia or whatever…
NO MORE MY FRIEND, NO MORE!
Reply
-1Bronze Breeze says:
Friday, November 20, 2009 at 2:12 am
Fli there is nothing to imagine about you other than you need to acquire some basic knowledge. At your stage of mental and physical evolvement, you are very much all what you’ve described yourself as: Just out of the Gobi desert, you are a monkey, you are inferior, you are an animal, you have no rights, your children are also animals. You think of it, in proportion to your little body, your big, fat head, your arm length proportionally longer than your small body, your yellowish skin, the thick, black, spiky fur covering your head and body, the type of food you eat, the way you live and behave and in your case factor in your low IQ…..You are indeed a primordial stage Primate.
Alice says:
Friday, November 20, 2009 at 5:17 am
I hate guns. :|
I’d throw the gun away and I would try to work together with that person. We have to work together to survive.
Empty words and corpses wont get anyone off the desert.
Master C says:
Friday, November 20, 2009 at 5:55 am
That goes double for so called Developed Nations.
The WORLD does not like racists, especially those posing as ‘better’ peoples. So remember the Human Rights Charter and the UN Declaration for Indigenous Peoples 2007 which 143 countries signed but these 4 nations did not sign :
USA, Canada, Australia, New Zealand (3 of which consider the England’s Saxe-Coburg-Gotha their sovereign) . . .
Like you said, NO MORE MY FRIEND, NO MORE!
+4a Chinese girl says:
Wednesday, November 18, 2009 at 3:02 am
Honestly, what’s wrong with those people? Lou Jing looks much better than 90% of the people who enter Chinese beauty pageants! Her skin color does not make her ugly! It really is horrible how they look down on her. What’s wrong with being half-black and half-Chinese? I think that mix is beautiful and something to be proud of!
Also, why are they trashing her father for leaving them? He didn’t know he got her mother pregnant! He shouldn’t be blamed for that. They’re just looking down on him because of his race. For all we know, he could be a very good, respectable man. Don’t judge him just because he is black!
And many people fail to point out the hypocrisy against women here. If a married man cheated on his wife and, say, got that other woman pregnant, many people wouldn’t reproach him half as strongly and passionately as they reproach Lou Jing’s mother! In fact, they’re more likely to blame the other woman, even though it was the man who was most at fault! It’s very unfair that this woman is receiving such torment when men who cheat don’t even seem get blamed much! This woman is actually very admirable to raise and protect Lou Jing by herself, even while facing many who must’ve looked down on her for her actions and expressed some unreasonable hatred towards Lou Jing.
I am very glad now that I was raised in the U.S. If I had been raised there, I’d be learning those same kinds of racist and sexist values that so many Chinese people have ingrained in them.
Reply
+6Dee says:
Wednesday, November 18, 2009 at 9:31 am
It is so very sad to read so much ignorance, intolerance and bigotry. This girl is stunning and even if she was not she is a human being. My father visited china many years ago and he had so many fond memories that I wanted to visit as well. But now I think I would rather not and it is a pity. Such a great country, such amazing history and such shallow people how did that happen.
That said I will treat every Chinese person I work with and meet with no prejudice until they show some against me.
This is just so very sad.
Reply
Lee Momolu-Sumo says:
Wednesday, November 18, 2009 at 1:01 pm
I have read some of the racist comment and also those in favor of Lou Jing. It’s true that Lou Jing shouldn’t be punish for her mother’s crime. Secondly, China is now a heavy weight on the world’s stage, the Chinese people should change their ways how they sees other human beings especially black people who are now living in China. There are over 2 billion in the world, and they are living all over the world: Africa, Australia, UK, EU, US, Canada, South America, Central America, Jamaica, etc, etc. I hope the Chinese Government will acts quickly to curb this situation before it turn into an economic boycott against Chinese products and markets around the world. Remember, the internet is seeing all over the world I’m in Canada and there I saw this racist and racism behavior unfolding before my eyes against this young innocence child it might appear manner in China but the world view might be different as the mental torture of this young child continues it might turn into a global political and economic problems for China in future.
Reply
+1Jon says:
Thursday, November 19, 2009 at 4:10 pm
Blasian FTW!!! Over in the states this is all us asian brothers are trying to produce!
Reply
danni says:
Thursday, November 19, 2009 at 8:29 pm
What a truly stunning young woman. The comments are really sad from Chinese netizens. It’s bad any bit different in China. If you go against the flow you’ll be criticised by the traditional majority of people.
Reply
capt. dude says:
Friday, November 20, 2009 at 4:50 am
Hah. This is preceisely why people say America is racist. When y ou can have motherfucker say something like US olymics team is diverse AND in the same sentence being racist???
WTF is wrong with this world man?
America is GREAT for many things. The image is great. BUT, the shit I don’t like about America is the HATRED and PROBLEMS is SO FUCKING DEEP ROOTED. 400 years of bullshit all rolled into one.
Reply
capt. dude says:
Friday, November 20, 2009 at 4:53 am
Ha. No wonders every month you have some poor bastard going allah ackbard on your stupid assholes.
Motherfuckers come clap me. clap the witness. Clap cats and clap dogs. clap faggots. clap bitch whores (women). I’m sick of living.
Reply
capt. dude says:
Friday, November 20, 2009 at 4:57 am
maybe I should go ackbar clap too?
let me break it down what this means before you arrrest me:
ackbar? not a word.
Clap? I meant 808 clap.
So there…
Reply
capt. dude says:
Friday, November 20, 2009 at 4:59 am
Just look at Amerikkkan soliders. FUcking walking time bombs clap clap clap clap clap woman and child ( mean whore and faggots).
Just clap me.
Reply
capt. dude says:
Friday, November 20, 2009 at 5:21 am
America? A big fucking social engineering project. Sorting motherfuckers into bins, bins build to fully dominate and control your mind! It is really they say jump you say how high! Illusory democracy. I can see why “they” thought this was a good plan. No, it IS A good plan. Tyranny works!
Reply
capt. dude says:
Friday, November 20, 2009 at 5:25 am
Come and clap this chink. I HATE AMERICA! DEATH TO AMERICA!
Reply
capt. dude says:
Friday, November 20, 2009 at 5:33 am
FUCK America! OBAMA is nothing but a slave put out there by the real masters. HA. America still using an evolved system of slavery!
EXACTLY. On “PR” outward facing level this is PROGTESSIVE. Massive progressive. It’s just lies though because OBAMA is Amerikkk’s Potemkin president! HA. The truth. I hope you read this. I’m a chink. You are a Potemkin president. Dear mr. president. Come and clap me with your CIA watch.
Reply
capt. dude says:
Friday, November 20, 2009 at 6:00 am
know this faggots whores crackers niggers chink: you all suck. How do you like that? EVERYONE IS RACIST. EARTH PLANET EARTH is racist. You whore mama is racist. you faggot kid is racist. you crackers niggers and chinks….all racist!
OBAMA? Racist nigger.
Me? Racist chink.
Reply
capt. dude says:
Friday, November 20, 2009 at 6:02 am
enough about faggot Obama.
Faggot Hu is suck off Faggot Obama right now I bet.
Reply
-1Alice says:
Friday, November 20, 2009 at 6:08 am
Ugh. Shut the hell up already.
Reply
capt. dude says:
Friday, November 20, 2009 at 6:42 am
Everyone knows in America, niggers hate chinks. Chinks hate niggers. Crackers hate all. Crackers and niggers work together to hate on the chinks.
It’s a serious game man. This hate business, ms. Alice. Do you knkow?
Reply
capt. dude says:
Friday, November 20, 2009 at 6:44 am
A game that the chinks is definitely losing, in America. Ha.
Reply
+1capt. dude says:
Friday, November 20, 2009 at 6:51 am
shutup little chink higher school girl before you get raped.
Reply
+1capt. dude says:
Friday, November 20, 2009 at 6:52 am
can you imagine? 99 niggers crackers and chinks in a room with little chink high school girl for rape?
Reply
capt. dude says:
Friday, November 20, 2009 at 7:11 am
Being raped is not so bad after you get used it. I’ve raped plenty of times.
+1capt. dude says:
Friday, November 20, 2009 at 7:12 am
I meant I’ve BEEN RAPED many times. It’s train on my ass man.
capt. dude says:
Friday, November 20, 2009 at 6:49 am
Ha, for real tho, there is NO GAME actually. More like a rape. It’s like in a room of 100 niggers, crackers and chinks, only 2 chinks there, so 98 niggers crackers and just pwn the chinks completely.
Right?
Reply
Dee says:
Friday, November 20, 2009 at 7:24 am
Umm, may I suggest valium? You are one unhappy dude, do you have a point somewhere in those comments.
People who make threats and insult others usually don’t have a real point to make and can’t handle a real conversation like an adult, is this the case here?
Anyhow if this is what makes you happy, knock yourself out :)
Reply
Trackbacks/Pingbacks
+1Heads-up to foreigners: “racism in China” is a cross-cultural conversation landmine | China Hope Live
Appalling Racism | ChinaGeeks
Shanghai Black Girl Lou Jing | ChinaHush
+3Chinese-Black Couple On Shanghai Metro | chinaSMACK
+1Schwarze Teufelchen und grüne Mützen – und was das Internet wirklich über die chinesischen Meinung verrät | Daily China
+1Wow Some People Are So Hateful - AznLover.com - the interracial AMWF AMXF Social Community
Wow Some People Are So Hateful - AznLover.com - the interracial AMWF AMXF Social Community
Dedicato ai coglioni che pensano che solo i bianchi sian razzisti - Politica in Rete Forum
Yes, - TheNewTopical.com
A New Kind of Idol: Lou Jing | Parlour Magazine
Links of Great Interest 10/2/09 | The Hathor Legacy
+1Black-Chinese Woman Unleashes Internet Scorn | China
Lou Jing: Racism Gone Wild? | Fool's Mountain: Blogging for China
SHANGHAIIST: China confronts racism as mixed-race star makes headlines | Daily Babel
Wants to know what the Chinese think of us? - The BN Village
Leave a Reply
Click here to cancel reply.
Name (required)
Mail (will not be published) (required)
Website
Notify me of followup comments via email Chinese ‘FHM’ (男人装) Magazine Controversial But Popular
Some Chinese netizens defend the popular but sometimes controversial 男人装 (Nan Ren Zhuang) magazine, the Chinese version of the men's lifestyle magazine FHM (For Him Magazine) that often features photographs of scantily-clad and sexually suggestive women.
Featured Posts
Recent CommentsMost Commentedin Shanghai ‘Black Girl’ Lou Jing Abused By Racist Netizens Dee: Umm, may I suggest valium? You are one unhappy dude, do you have a point somewhere in those comments. People who...
in ‘Mother, China’ Music Video Captures Overseas Chinese Reno Studios: Please credit MV’s producer and creditor – Reno Studios. Thank you for promoting this great MV...
in Shanghai ‘Black Girl’ Lou Jing Abused By Racist Netizens capt. dude: I meant I’ve BEEN RAPED many times. It’s train on my ass man.
in Shanghai ‘Black Girl’ Lou Jing Abused By Racist Netizens capt. dude: Being raped is not so bad after you get used it. I’ve raped plenty of times.
in Shanghai ‘Black Girl’ Lou Jing Abused By Racist Netizens Dee: And the problem here would be? E molto triste vedere il razzimo nella mia cara italia. Sono Italian come te, sono...
in Nude Undeground Rafting By Chinese Girl & Black Man drmmhmd: perhaps we agree on some things. i do not travel first class except in unusual conditions and i prefer to pay 40 to 80 kuai...
in Shanghai ‘Black Girl’ Lou Jing Abused By Racist Netizens capt. dude: can you imagine? 99 niggers crackers and chinks in a room with little chink high school girl for rape?
in Shanghai ‘Black Girl’ Lou Jing Abused By Racist Netizens capt. dude: shutup little chink higher school girl before you get raped.
in Shanghai ‘Black Girl’ Lou Jing Abused By Racist Netizens capt. dude: Ha, for real tho, there is NO GAME actually. More like a rape. It’s like in a room of 100 niggers,...
Shanghai 'Black Girl' Lou Jing Abused By Racist Netizens
'China Does Not Have Any Men Suitable For Me'
Kitten Killers Return
Young Girl Argues With Anti-Chinese French On Airplane
"Zhejiang University Girl" Exposed By Human Flesh Search
Japanese & Chinese Students Fight In Shanghai
Unfaithful Fiancée Gets Pregnant, Publicly Beaten By Man
Nude Undeground Rafting By Chinese Girl & Black Man
Getting In A Relationship Across Different Generations
South China Sea Confrontation, Chinese Netizen Reactions
Popular Tags
abuse business caught controversy crime death discrimination education embarrassment faces fake family fights foreigners funny government officials humiliation inspiration interests lifestyle love mistakes money Mop NetEase news outrage patriotism & nationalism perception of other countries poverty pride schoolboys schoolgirls sex shame Shanghai shocking silly strange students Tianya universities violence work youthAdvertise Here
Recent Posts
Funny Snowmen & Snow Sculptures From Northern China Thief Returns Stolen Wallet, Praised For Professionalism Dumping Girlfriend Because Her Breasts Are Too Small? Old Beggar & War Veteran Takes Leftovers, Not Money Chinese ‘FHM’ (男人装) Magazine Controversial But Popular Recent Comments
Dee: Umm, may I suggest valium? You are one unhappy dude, do you...Reno Studios: Please credit MV's producer and creditor - Reno Studios. Th...capt. dude: I meant I've BEEN RAPED many times. It's train on my ass man...capt. dude: Being raped is not so bad after you get used it. I've raped ...Dee: And the problem here would be?E molto triste vedere il...Most Commented
Shanghai 'Black Girl' Lou Jing Abused By Racist Netizens'China Does Not Have Any Men Suitable For Me'Kitten Killers ReturnYoung Girl Argues With Anti-Chinese French On Airplane"Zhejiang University Girl" Exposed By Human Flesh SearchMost Viewed
Beijing Prostitute Posts Customers' Mobile Numbers & AIDSDaughter Poses As Nude Model For Painter FatherNude Undeground Rafting By Chinese Girl & Black ManShanghai 'Black Girl' Lou Jing Abused By Racist Netizens'Happy Farms' Game Destroys
2 comments:
The articles in this particular a part of the blog are really excellent. High Quality, long lasting Garden cricket net using club standard 2mm thick, 50mm mesh cricket netting, optional roof netting for extra safety in a one piece cricket net with guys, ropes and pegs.
S.No. Links
1 MDU Results 2017
2 MDU Date Sheet/Time table
3 MDU Rohtak UG/PG Results
Post a Comment